Transcript

arhgef15-202

ID
ZDB-TSCRIPT-090929-5944
Name
arhgef15-202
Previous Names
  • arhgef15-001
  • si:dkey-2j6.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022630 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022630|OTTDARG00000018614|ZDB-GENE-060526-292 arhgef15|OTTDARP00000018934 DKEY-2J6.3-001 LG_ CR450749.7 Danio rerio protein_coding NOVEL, 1549 bp
CATTCTCAAACACATTTTGTCATCCCCAGAACCTCTATAT
CAAATTTACCAGGCTAAGCTCTCGAAAGAAGATAGTCAGA
TCCAAACTGTTAGTCCTGATTGCAACAGGAGAAGTGTTAG
TGAAACCCTGGGCCTTGAGGGTCATGGAAGCCTGGGAGTA
GTTGGCACCCAATCAAAAAGAGGTCCTGAGGAAATTACAC
TCTGGCAGGACTTACCAGTGGTGAAGGAAAGCGGAATGTT
GCACAAGCTCACTCGCACTGAAAAACAGAGACAAGAGAGC
ATGTTTGAAGTGCTCACCTCTGAAGCCTCCTACCTTCGCT
CCCTGCGGGTTCTGAAGGATCATTTCCTAGGGTCACGGGA
ACTTAATGAGACTCTGGTCATTCATGATAGGAAAGTCCTC
TTCTCCAACCTCCTGCAGGTCTATGAAGTTAGCGAGAGGT
TTATAAGAGATCTGCTGAAGAGAGTGGATGAGAGTGTGGT
GATATCTGATGTGTCTGACATAATTTATGAACACTCAGAA
AATCATTTTTCTGTCTACATTGATTATGTCCGAAATCAGC
AGTACCAAGAGAAGACCTACAGCAAACTGATGGAGAGTAA
TACAGATTTTGCAGTTGTAATGAGACGCCTGGAATTATCT
CCACTCTGTAAACGTTTGCCTTTCACATCCTTCATGCTTT
TGCCCTTCCAGCGAATAACACGCATCAAAATCCTTATACA
GAGTATCCAAAAGCGGACTGCAAAAGGCACGAAAGAGGAG
GAGACAGCTTCTAAGGCCCTAACCTCAGTGTCTAAGCTTA
TCACACAGGCAAACCAGCAGGTGGGACAGATGAAACAGAT
GGAGGAGCTGATAAACACATCAAACAAATTGGAGTTTGAC
AAAGTTAAGGTCATTCCAATTGTCTCTAAAACGCGTTGCC
TAGAAAAACACGGAGAACTACAAGAACTGAGTAAAAGAGG
GTCTCTCTTCAGTATGCGAAACAGATGCTCCCCTGTGTAC
ATGTTTCTTTTTAATGACCTTCTCATTCTCACAACTAGGA
AAAGTGGTTGTCCAGACCGCTTTACGGTGATCGATTATGC
TCATAGGTCTTTGGTTCAGGTACAGGCCACAGTAAACAGT
CTTGGTCCACACTTGGATCATTGTTTCAGTTTGACCCTCC
TGGAAAACCATCGGGGTAGCACCTGTGAACACTTGCTCAA
GGCTAATACAGAGTCAGACATGCATAGGTGGATTGCTGCT
TTCCCATCAATTAATGAAACCTTTGGGGAGGAGAAGATTT
ATGAAGATTGGGATTGTCCTCAAGTGCAGTGTGTCGATCG
GTATGTAGCTCAACAGGCAGATGAGCTTAGCTTGGAGGTA
TCTGAGGTCATCAATGTGCTGCGCAAAACCAACGAAGGTT
GGTACGAAGGCATACGTCTCTTTGATGGAAAGAAGGGCTG
GTTTCCAGCAGAGAACACACTAGAAATAACCACTGATCAT
CAAAGACGACGGAACGTGAGAGAGAAGTACCAAATTGCAC
AGTCAACCAGTCAGAACAGTCAAAGCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations