ZFIN ID: ZDB-TSCRIPT-090929-5944
Transcript Name: arhgef15-202
Previous Names: arhgef15-001, si:dkey-2j6.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022630 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022630|OTTDARG00000018614|ZDB-GENE-060526-292 arhgef15|OTTDARP00000018934 DKEY-2J6.3-001 LG_ CR450749.7 Danio rerio protein_coding NOVEL, 1549 bp
CATTCTCAAACACATTTTGTCATCCCCAGAACCTCTATAT
CAAATTTACCAGGCTAAGCTCTCGAAAGAAGATAGTCAGA
TCCAAACTGTTAGTCCTGATTGCAACAGGAGAAGTGTTAG
TGAAACCCTGGGCCTTGAGGGTCATGGAAGCCTGGGAGTA
GTTGGCACCCAATCAAAAAGAGGTCCTGAGGAAATTACAC
TCTGGCAGGACTTACCAGTGGTGAAGGAAAGCGGAATGTT
GCACAAGCTCACTCGCACTGAAAAACAGAGACAAGAGAGC
ATGTTTGAAGTGCTCACCTCTGAAGCCTCCTACCTTCGCT
CCCTGCGGGTTCTGAAGGATCATTTCCTAGGGTCACGGGA
ACTTAATGAGACTCTGGTCATTCATGATAGGAAAGTCCTC
TTCTCCAACCTCCTGCAGGTCTATGAAGTTAGCGAGAGGT
TTATAAGAGATCTGCTGAAGAGAGTGGATGAGAGTGTGGT
GATATCTGATGTGTCTGACATAATTTATGAACACTCAGAA
AATCATTTTTCTGTCTACATTGATTATGTCCGAAATCAGC
AGTACCAAGAGAAGACCTACAGCAAACTGATGGAGAGTAA
TACAGATTTTGCAGTTGTAATGAGACGCCTGGAATTATCT
CCACTCTGTAAACGTTTGCCTTTCACATCCTTCATGCTTT
TGCCCTTCCAGCGAATAACACGCATCAAAATCCTTATACA
GAGTATCCAAAAGCGGACTGCAAAAGGCACGAAAGAGGAG
GAGACAGCTTCTAAGGCCCTAACCTCAGTGTCTAAGCTTA
TCACACAGGCAAACCAGCAGGTGGGACAGATGAAACAGAT
GGAGGAGCTGATAAACACATCAAACAAATTGGAGTTTGAC
AAAGTTAAGGTCATTCCAATTGTCTCTAAAACGCGTTGCC
TAGAAAAACACGGAGAACTACAAGAACTGAGTAAAAGAGG
GTCTCTCTTCAGTATGCGAAACAGATGCTCCCCTGTGTAC
ATGTTTCTTTTTAATGACCTTCTCATTCTCACAACTAGGA
AAAGTGGTTGTCCAGACCGCTTTACGGTGATCGATTATGC
TCATAGGTCTTTGGTTCAGGTACAGGCCACAGTAAACAGT
CTTGGTCCACACTTGGATCATTGTTTCAGTTTGACCCTCC
TGGAAAACCATCGGGGTAGCACCTGTGAACACTTGCTCAA
GGCTAATACAGAGTCAGACATGCATAGGTGGATTGCTGCT
TTCCCATCAATTAATGAAACCTTTGGGGAGGAGAAGATTT
ATGAAGATTGGGATTGTCCTCAAGTGCAGTGTGTCGATCG
GTATGTAGCTCAACAGGCAGATGAGCTTAGCTTGGAGGTA
TCTGAGGTCATCAATGTGCTGCGCAAAACCAACGAAGGTT
GGTACGAAGGCATACGTCTCTTTGATGGAAAGAAGGGCTG
GTTTCCAGCAGAGAACACACTAGAAATAACCACTGATCAT
CAAAGACGACGGAACGTGAGAGAGAAGTACCAAATTGCAC
AGTCAACCAGTCAGAACAGTCAAAGCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arhgef15-202 Contained in:
[BAC] DKEY-2J6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022630 (1),  Ensembl_Trans:ENSDART00000163034 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)