ZFIN ID: ZDB-TSCRIPT-090929-5783
Transcript Name: si:dkey-193c22.1-201
Previous Name: si:dkey-193c22.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022437 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022437|OTTDARG00000018477|ZDB-GENE-030131-7957 si:dkey-193c22.1|OTTDARP00000018799 DKEY-193C22.1-001 LG_ BX571674.7 Danio rerio protein_coding NOVEL, 1578 bp
GCAGGCTGCAGTTTGCGCATGCCGAAAAAGCAATAGGGAA
GTTCATTCAGTGCATCTTGGCCATCTGGTCTTATTCTTGT
ATGTCATATGCAGGATATGTTTTAAGACGGTGCACTCTTT
TACAACACTGATGTTCTGTTTTCGGTGTCAGCGCTAATCA
CCACCAGCTGCAATAAAAACATGATTTCGCTGAAGTGCTG
TGTGTCTATTCCAGCAGTGGCTGGAGCATTATTAGTGGGC
CTCCCTTACAGTATCTCTTTAGTTGCCCAGTGGCTCTATG
GCTGGCCCAATAAACCAGGATATCAAAAATATATAGAGGC
TCTCAAACCAAGGCGCATATACTGTCTGGCAAGAGCTGTG
CTGGAGATGCTGAAGTATCTGCAGTATGGCAAACTGTACT
TTCAGTGGAAACTGTGGTACAGTAATGACAAAAATAACAA
GCATTATGTGAAAGGCATCACGTTTGGTCGGCGAGGGAAC
AAGCTAGATTTATATTATTCACCAAGACTGGAGCTTTCTG
ATGAGTCTCCTGTACCAGTTGTAGTATTTGTCTATGGAGG
AGCCTGGGGATCAGGAGATCGCTCCATTTACTGTTTGTTA
GCTTTACAAATGGCAAAAGAGCTTAATGCATCTGTTATTT
GTCCAGATTATTCCATATATCCCAAGGGAAATGTTTTAAA
CATGGTTCAAGACATTAGTGACAGTCTGCTGTGGGTGAGA
CAAAAGGGACATGCATTCAGTCTTGATCAAGACAACATAA
TATTAATCGGTCATTCAGCAGGGGCTCATCTGTGTGCCCT
CACCTCACTGTTTCTGGCCAGCAATGTAGAAGAGCTCTTC
ATTGAGACCAACAAACAGAAAGATTTGGTCACTGCCATTA
AAGGAATCATCGGTCTGAGTGGAGTTTACAGCATAATGGA
TCATTATAACCATGAGAAAGTGCGGGCTGTTGAATACGTG
TCAACTATGCATAAAGCCATGGATGGTGTGGAGAACTTTG
ATTATTACTCACCAACCTCATTACTCAAGAAAATGAAGGA
GGATCAGTTGAAACGGGTTCCTCCAATGGCTTTGTTCCAT
GGTACCAATGACATCATAGTTCCTGTGGAATCATCCGTGA
GGTTCTCTGAGCTCCTCACTTCCCTTTCTATCCGGATGTC
TCTGTATCTCATTCCTAAAATGAACCATACTGACATGGTC
ACTGATCTTATGGCTCCAGACAGGCACTTTTACCACACTG
TTTATGGCTGTATTAAACATGAGTACAGTAAATTTCAGAC
TCATACTGACTGATTGATATTTTCATTAAAGTAATGAAAT
TAATATAATTTTTCAATGCCATACAGTCACAGTATTTTAG
ATATAGCATGTCATTTTTCATTTCACTGTAAGTTGACACA
TTGTGAACTTACACAAGTGCATTTTCTTTTCTACTGAAGA
ACCGTTTTCAATAACTCCCTATACAAAATGGTAACGTAAA
ATCATGTTGGATCTGTGCTTGTTAATTTATTGTGGGTAAA
CATACATATAATTTACCTGTGTAAATAATACAAATAAAAT
ATAAATAATATATTCTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-193c22.1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000022437 (1),  Ensembl_Trans:ENSDART00000131323 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN327087 (1) 890 nt
GenBank:DN766372 (1) 832 nt
GenBank:DT876888 (1) 813 nt
GenBank:DN597329 (1) 804 nt
GenBank:DN766482 (1) 747 nt
GenBank:AW280604 (1) 496 nt
GenBank:AW279682 (1) 367 nt
CITATIONS (2)