header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5782
Transcript Name: atp1b2b-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022436 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022436|OTTDARG00000018476|ZDB-GENE-010718-1 atp1b2b|no_translation atp1b2b-002 LG_ CR854980.8 Danio rerio protein_coding KNOWN, 429 bp
CGGCTGGAAGGAGTTCTTCTGGAACCCGAGGACCCGCGAG
TTCTGCGGGAGGACCGCGAGCAGTTGGGGTCTGATTCTGC
TGTTTTATCTGGCATTCTACATATTCCTGGCTGGATTGTT
TACTCTCACCATGTACGTAATGCTGCAGACCCTCGATGAC
CACAGACCAACATACCAGGACAGACTTTCAACTCCAGGGA
TGATGATCAGACCTAAAGGAGAGCAGCTGGAGATTGCTTA
TACCACCGAGTACACAGAGACCTGGGAAAGATACGTGCAG
GCTCTCAATAACTTCCTCTCACGTGCGTTTATTTAACAAC
CCTAATGCTGCATGTATTGCACAGTAAATATAGACATTAG
GCATTTGATTAAAGCTACGGTATCTAACTTCTGAAAATCT
AGTGGTTAATAAATGAAGAGCTTACAGGC

atp1b2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA atp1b2b-201 (1)    Ensembl 2432
ncRNA atp1b2b-002 429
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atp1b2b-002 Contained in:
[BAC] DKEY-89J23 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022436 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BG738984 (1) 429 bp
CITATIONS (1)