Transcript

mark4a-202

ID
ZDB-TSCRIPT-090929-5772
Name
mark4a-202
Previous Names
  • mark4a-001
  • si:dkey-85k8.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022423 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022423|OTTDARG00000018465|ZDB-GENE-060531-156 mark4a|OTTDARP00000018789 DKEY-85K8.8-001 LG_ BX547938.9 Danio rerio protein_coding NOVEL, 2330 bp
ATCGGAGTTTACAATGGATTTCCCAGAAACAGCGTTCCTT
TCATTGCAGATGGCTTTGGAGGAACTGTCAGTACCTAAAG
CGTGTTTGTTTTGGGAGAGCTGCTCACCTTCAGGCTTGGT
CATGAACTCCCCTTCCCTTCTACCCAAATCATGCGTCTCT
GGTGGCGAGTCGTTCAGAGAAGGGGACGAATGTGTCGAGT
CGCTCACTGGGTGCGAGATGTCGTAACTCCATGGCTTCTT
ACTCAGACGAGCTACCGCACATCGGAAACTACCGGCTCCT
TAAAACCATTGGCAAGGGCAACTTTGCTAAAGTCAAACTG
GCCCGCCACATCCTCACAGGCAAAGAGGTTGCAATAAAGA
TTATTGACAAGACTCAGTTGAACCCAACCAGCCTACAAAA
GCTGTTCAGAGAGGTACGGATCATGAAGACTCTACATCAC
CCAAACATTGTGCAACTCTTTGAGGTTATCGAAACAGAGA
AGACGCTTTATCTTGTGATGGAATATGCAAGTGGAGGTGA
GGTGTTTGATTATCTGGTGTCTCATGGGAGAATGAAAGAA
ATTGAGGCTAGAGCCAAATTCAGACAAATTGTGTCAGCTG
TTCACTACTGTCATCAGAAGAATATTGTTCACAGAGATCT
GAAGGCAGAGAATTTGCTGTTGGATGCAGATTCCAACATA
AAGATAGCAGACTTTGGCTTTAGTAATGAGTTTACATTGG
GGAATAAGTTGGACACTTTCTGCGGTTCCCCGCCTTACGC
TGCTCCAGAGCTGTTCCAAGGAAAGAAGTATGATGGGCCA
GAGGTGGACATCTGGAGCCTAGGGGTCATCCTGTACACAC
TGGTCAGCGGATCTCTTCCTTTTGATGGACAGAACCTTAA
GGAGCTGCGTGAGCGAGTGTTGAGGGGAAAGTACCGTGTG
CCCTTCTACATGTCCACAGACTGTGAGGGGATTCTGCGCA
GATTTCTTGTGCTCAATCCCAGCAAACGTTGCACTCTAGA
GCAAGTGATGAAGGATAAATGGATGAATGCAGGCCATGAT
GGTGATGAGTTAAAGCCACACATTGAGCCAACTGAAGACT
ACAGTGACGCCAACCGCATTGAGATTATGGTCGGGATGGG
TTTCACTACAGAGGAGATTAAGGACTCTTTACTCAATCAG
AAATATAATGAAGTCACAGCGACATATCTACTGTTGGGCC
TGAAGACTGAGGATGGTGCTGAGTCACGAGTTAGCGGCAG
TATGACATTGCCGCGGGTGCGTCCGAGCCCAATTACCAAT
GGAACCAACAAACACTCCTCCTCTTCATCATCTTCCTCAT
CCTCACACAGCAAGACTCAGCGCAGCGCCTCTACCTACCA
CCGCCAGCGACGGCACAGTGATTTCTGTGGTCCCAGCATG
CCTGTGATGCACCCTAAGCGAAGCCCAACCAGCGGCGGAG
ATCGTGAGCTTCGTGAGAGCCGCATGCCACCAAGGAAGGC
CAGCTGTAGCGTTATGGGCAGTCGGACTCTGCCACCATCA
AGTCCAATGGTCAGCACCGCCAACAACCCCAACAAGGCTG
AGATACCTGATCGACGCAAGGAGATGACAGCCACCACTAA
CAATATCCCAGGAAGCACTATGACCCGCAGAAACACATAT
GTATGTACGGATCGTTCCAGCACTGACCGACACTCTCTGC
TGCAGAACGGCAAAGACAACAGTATTGTGGGAGCGGGAGC
CTCCTCCTCCTCGTCCTCTGGCGAGCGATGTCGGCTGACC
CGTGGATCCACCATCCGGAGCACCTTCCATGGGGGTCAGC
TCCGTGACCGTGTACCGCCTACCTATGGACCTCCACCCAC
ATCGCCCACCCTCAGCCATGACGCCGGAGCCCTGCCGGCC
AATGCCCGCAGCCGGGCCACTTCTAATCTGTTCAGCAAAC
TCACCTCCAAACTCACACGCAGGGTCTCAAATGAATCTGA
GGGAGTCAGCAGATCTTCGGTCACAGGTGGCCATTTATCT
GGGGATCAGAAAGCGTCCGAGCCCTGGGGCGGGGGAGGGG
GGTGGGATGTAAGGGCTCGTCTCTCCCGTCCCCCTCGGGC
CCCTGCAGAAGTGGTACTGGCCTTGCGTGAGGCAGCGAGG
GGATGCGGCTGCCAGGTCCGGCACGCTGGCCCGTTTCTGC
TGTGCTGCAGTCATGGGGCGGCAGGGTCAAAAGTCGCATT
CCAAGCGGAGGTGTGCCAATTGAGTGTGGGTCCCGCAGAG
GCAAACGGAGTACGCTATACACGCCTGTGGGGGGCCCCGC
TCGCCTTCAGGCATATTGCATCACAGATCTCAAAAGAGGT
AGAGCTTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations