header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-575
Transcript Name: kif26aa-202
Previous Names: kif26aa-001, si:dkey-31d8.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005896 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005896|OTTDARG00000005437|ZDB-GENE-041001-148 kif26aa|OTTDARP00000005278 DKEY-31D8.1-001 LG_ BX255932.4 Danio rerio protein_coding PUTATIVE, 5147 bp
CTGCCCAGAAGCTGAACCTCTCCAAACGGAAGAAGCCTCA
GCCACTTCCGCCATCTCCTCCGGACCCAGAAGAGCCGTTC
TTCTACACTGATGGCTTCAGTGCCGCCCTGCAGCTCTCTC
CCCCAGCTGTACCCCCGTGTCTCCTCAGGGCAGGGGCAAA
GGTTAAGGACAGCCCTGGGATGGGAAAGGTGAAAGTGATG
GTGCGACTATGTAATGCCAAAGGATCGAGAGACACCTCAG
AATCCATGTCCTTTCTCAAAGTGGACGCCCATAAGAAACA
GCTGACGTTTTGTGAGCCGCCCATGTGTGCCCGCACCGCC
TCTGCCAACGCCCCAAAGATGTTTACCTTTGATGCCATCT
TTACCCAAGATGCTTCCCAGGCGGAGGTGTGCTCAGGGAC
AGTGGCAGAGGTTATCCAGTCTGTGGTCAATGGGGCAGAT
GGTTGCATCTTCTGTTTTGGTCAAGCCAACCTTGGCAAAA
GCTACACCATGATCGGCAGGGACAGCTCTACACAGAGCTT
GGGTGTTGCACCCTGCGCAATCTCTTGGCTCTTCAAGCTC
ATTGAGGAAAGGAAAGAGAAGACCGGCACAAGATTCTCCA
TTCGAGTGTCTGCTGTGGAAATCTGCGGCAGAGAAGAGGT
GTTGAGAGACCTGTTGGCTGACTTTTCTGCAGGAACTTCA
CAGGACAGTCAGAGTGCAGGAATTTCTCTGCGAGAGGACC
CAGTCTGTGGCTCTCAGCTGCAGAACCAGAGCGAGTTGCG
GGCATATTCAGCTGAGAGAGCGGCATTCTTCCTGGATGCA
GCTCTGGCAGCTCGTAGCACCACCCGACCTGACTGTAAGG
AGGAGGATCGGCGCAATTCTCACATGCTCTTCACACTGCA
CATATCCCAGTACCGCATGGAGAAGAGCAGCAAAGCTGGA
ATGTCTGGGAATCGTAGTCGCCTGCATCTTCTGGACTTAG
GAAGTTGTGAGTCTGATCTGAGTCAAACCCGAGATGGAGG
AAGAGGCCAGTGTTTGTCATTAGGTGCCCTTGGAAATGTC
ATTTTAGCCTTGGCCAATGGAGCCAAGCATGTGCCATACA
GAGACAGCAAGCTTACCATGCTGCTGAGGGAATCGCTGGG
CAACATCAACTGTAGAACCACCATGATCGCCCACATCTCT
GACTCGCCAGCCAATTATGTTGAATCTCTCACCACTGTGC
AGCTTGCCTCCCGTATTCACCGCATGAGAAAGAAGAAATC
CAAGTATGCATCAAGTTCCTCTGGAGGGGAGAGCTCCTGT
GAAGAGGGACACATCAAACGAAGACCCTTCCACCCTCGGA
CTGTGGCTCTTGACCCAGACCACCCTGCAGTTTTATCCAG
TGATCCAGATTACTCATCCAGTAGTGAGCACTCATGTGAT
ACAGTGATCTATGTTGGGCCTGGTGGGGCCCCTATCTCTG
ACCGCGAACTCAGCGACAATGAAGGTCCCCCAGCATTTGT
TCCTATCATTCCCTCCCTGAACAAGAAGCGTGTAAAAGAG
GGATCTAAATCTGATGGGGATCACCTCAAATGTAACACCT
TTGCGGAGTTACAAGAACGACTAGAGTGTATTGATGGCAG
TGAAAGCACATCTGTTTTCACCAGTGAAGCAAAAGTCCTG
CAAACAGCCTTAAAATCTGGAGCGGACAAAGCATCAGAAG
GCATTACCTTATTGACAAGGACTGCTAAGTCTTCTCTTCA
AAAGCCTACAAACTTGGGAGCTACGTCTGAAATAAACACA
ACACAGCAAGATTCAGAACCTGTTGTGAGAGGAAAAGTGT
TTAGTAGAGGGGCTATACAAAAACCCAATGCCTCTTTCTC
CACACAGAACATATCAAAGACGTCAGTTTTGAATACTGAG
TGTGGTTTAGCCACAAGGACACCTCCAGTGGGTATGAGCC
AGCAAGCCCTTAGACAGGGAGAACAAAATGACTCCCCAAT
TACTGACAGATCCCAACATCACGGTAGAAGTCCTATGGAG
GTGAGCCACTTACGTGCTGCTTTGAGGAACAGGTGCTTCG
ACAGAGATGTTTTAAGGACTACAGTTACATTGCAGCAACC
TGTGGAGCTCAATGGAGAGGATGAACTTGTGTTTACAGTG
GTTGAAGAGCTACCTGCTGGTCTGGTTCCAGACAATGGGA
CACCCTCCAGCATAATTAGCTTCAATAGCAACTGTTCTTT
GCAGGCTCTGGCTTCTCACTCACGGCCTGTTAGTATTATC
AGCAGTATCAACGATGAGTTTGATGCTTACACATGCCAGT
TAAACAAGTCCAATCTGAACCAAGGTGCTTCTGGTGCTTC
CAATTCAAAAGAGGAATTTACAGCTGGACATGCAGCACAT
TCTTCAACTGGTGCTTGGACTTGTAATTCAAATCTTTGTA
CCCCATGTAGGGATGAAACTGATAGAAGCCACTCATTAAA
GGGAGTTTGCAAGGGACTAGTTAGCAGCTCCATGATGGAT
TTACCTGGTAGATTACATATGGAGTCTGTCTCACAGCAAA
GAACAAGAAGTCCACCGGGTGACAGTGGAATTTGCTATTC
AGATCAAGGTTATGATTCTGCAACTGTTGATACGTTGTCC
ATATCTAAGTGCCCTCTAACTCATGACAGTACCAAAGCAT
CTCTCAAACCAATGAGATCTAATAGACTATTGGCCTCACA
ATCTGCCCAGATCTCATGCCTCTCTAGTCTCCCTAGAAAA
AGCACCCAAATTTCATCTTCAAGTAGTAGCTACAGCCATG
AACTGCAACGTCAAGGTAGTAGAATAGATGAACAATGGAG
CCACTCTAGCAGTGGGCTGCACTCAGCCAGGAATTCTGAG
TTTAGCTCTGTTGGCAAACCACCAAAAAATGGCACAAGTG
GAATTCCATCTAGAAAGATAAGTGGGAATAGCAACAGTGT
ACCTCGCCCTCCCAAAATGCATGCATCGTCCACATCTCAA
AGGGTTGTGGATGGTTGTGAAAAGTCCAGTGTTAAGAAAG
GGGAGCTGAGCAAGATGCCTCAGCTCAAGCGAGGAGCCAC
CACTCTTGGGATGGTATCAGTTCCCCATAGCTCCTCTGAA
TTAAAATGGGGTAATGATGCCTCGCAATCAACTGGTAGCT
TAAAATTCTCGTCCCTGGGAAAGAGAGCTAATGGACAGAA
GAGTAGCATGATTCCTAAGTCTGGAAGCATGTCACCTCCT
GCTCCACCTGTGCGAAAATCCAGCCTTGACCAGAGAACAC
GGATTTTGTTGTCTCCTAGTGCCTTAAAGTCTGTAGGTAG
TGATGGAACAAGACTGTCTTCATCTAAAGCATCTGTTTCT
GAAGAGGACTTTGATGTTCGAGGTAAAGGGGATTCCTTTA
GCTTTAGATCATCCAGCCTGAAGACAGCTTCGAGTCTCAG
ATCACACAGTGCTAAAGGAGACAATGGAAGGCATTTTGGT
AGTCTTATGTCCCTTGAAAGGTGTGATAGTTTAACCTCAG
TGGGTTCCAGACCCGGAACATCAAGAGAGAACAGTAATGT
CAGTATCAGTAGCACTGGCAAATCAGCTAAAATGGTGCCA
AAACTTGGGGCTTCTTGTCCCTTATCTACACCAACTGCCA
CTTCCCCTCCATCTACTGGTGGAATTTGTAAGCTTGGACA
GATAAAAGCTAGTTTATCTCCTAGAGCCATTGTTGGAAAT
GGCAACAAAGGAAAAACCTTGTCAAGTACTGGTTCAAAGT
CTATTAGCTCATCCACCAAGTTCCTTGCCACCTCAGCCAC
TCGGAATGCAAGTCTACCTCCAACTGGAAAAACCCCAACT
AGGTCTGTCACGAGTTCCAGTACTAAACAAGGAAGGGGCA
CTATTATGGGCACAAAGCAAGCGCTCCGTGCAGCCAACAG
TCGGGTCAGTGAATTAGCAGTTGGTAGCTCCAAGAAACAC
CTCAGGGGTTCTGACCAAGCAGATGAAAATAGTGATGCCA
GAACTTCCAGTGAAATGCCACCAGCTACCCCTTTGCCCTC
TCCGTACAGCAAGATCACTGCCCCTCGCCGACCTCAGCGC
TACAGTAGCGGACACGGTAGTGACAACAGCAGTGTACTTA
GTGGTGAACTGCCCCCTGCCATGGGACGCACTGCACTTTT
TTATCACAGTGGAGGCAGTAGTGGCTATGAGAGCATGATC
AGGGACAGTGAAACTACAGGCAGTGCATCTTCTGCCCATG
ATTCCATGAGTGAGAGTGGAGTGTCCACGACCAGTCGAAC
AAAGGCCTCAAAATCCCCCAAAAAGAGATCTAATGGCCTA
CAGCGGCGCCGTCTGATTCCTGCTCCTCTGCCAGACACCT
CTTCCCTGGGCAGGAAAGTTGGTGCAGCAGGACAGTGGGT
CGATCTGCCCCCACTGGGTGGTACAATAAAGGAACCTTTT
GAGATCAAAGTGTATGAGATTGATGATGTGGAACGCCTTC
AGAGACGCAAAGAAGGTTTAACAGAGGGTTTGCAGTACTT
CAACGCCCGTCTTAGGATGCTGGAGAAGAGGCAGCAGCAG
ATCAGGGAGTTAAGAGCCAAGCACGAGAAGCTGAAAAAGG
AGTTGGAGGATGCCAAGACTCGACTCATGCTGGACCCCAG
CAAATGGATGGGAGAATTTGATGTAGACCCAGATCTGGAC
CAGGAGTCACATGACTACCTGCAAGCTCTGGCTCAGGCCA
CAGGAGACCTGGAGTTTTGTGTCAACCTATGCAAGTCTCG
CGTGATGATGGAGACCTGCTTCGATATCGCAGTGCCCGCG
ATTCCAGGACAGAGTGGACAACAGGAGATGGAGGTTTAGA
AGAGAATAAAACAAGATGCTATTTGCAAGCTAGCTGTGAG
TTATGGCAAGAACATGTTTTTTTTTTTTAAAGACTGACCT
GCTTCGAGTAATGCAACAGTTGACGGTAATGAACATGCAT
GGGAATACCATGAAATGCTGAGAAACAAAGAGACTACAGA
ATAAGAGTAAGATCGTGTCCTGAGATCTTCACTAACGTTA
CCAGAAAGTGCCTTAAACCAAAAAATATCAGATGAAATAA
ATAAATAAAAAAATCCCTAGAATTATCTTTGTTTTTAAGA
TTGGTGCTAGTACTGAAACCAACTTTCCCAAGTACACTTT
GAAAAACAAAGTATTGTGCATTGCAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kif26aa-202 Contained in:
OTHER kif26aa-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005896 (1)
  • Ensembl_Trans:ENSDART00000136251 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH464898 (1) 818bp
    CITATIONS (2)