ZFIN ID: ZDB-TSCRIPT-090929-574
Transcript Name: prph2l-201
Previous Names: prph2l-001, si:dkey-85n7.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005895 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005895|OTTDARG00000005436|ZDB-GENE-041001-147 prph2l|OTTDARP00000005277 prph2l-001 LG_ BX255913.8 Danio rerio protein_coding KNOWN, 1957 bp
ATCATCCTGAAATAAAATGAGTTTTACGACCAGACATAAA
AAATTACAGCGGATACGGTAAACTCGACACTTTCCGTTGA
CAATGGCCGTCTTAAAAGTGACATTTACGAAGACCAATAG
AGACAAACTGGCCCAGGTTTTATGGGTTTTGAACTGGGTG
TCTGTGGTGACTGGAGTGACGCTCTTCAGCATGGGCTTGT
TCTTAAAGGTGGAGATTGAGAAGAGGCGGGAGCTGATGTC
AAAAGAGATCGACTCGGTGCCAAACATGCTTATCTGTGTT
GGCCTGACTGCATGTGCGATCAACTTTTTGGGGGGAAAGA
TCTGCTATGACTGTGTGGATACAACCAAGTTCCTGCGATG
GAAGCTGCTGATGCTGCCTTACATCACATGTACCTTTTTC
TTTACGTTCTGCATCCTCGTGGGTGCCCTGATGTGCTACA
GCATGCGCAAAGACCTGGAGGAGTCCCTGTATTTTGGTTT
GCGAGATGCCATGCGCTACTATAAAGACACTGACATGCCG
GGACGCTGCTATATTAAGCGCACTATGGACATGCTGCAGA
TGCAGTTTCAGTGTTGCGGTAACGGAGGTTACAGAGACTG
GTTTCACATTCAGTGGATCAGTAACCGCTACCTGAATCTC
AGCAACAGTGATGTTGTGGAGCGGATTCGGAGCAATGTGG
AAGGGAAGTATCTGATAGACGGGGTGCCGTTCAGTTGCTG
TGGCCTATATTCACCCCGGCCCTGCATTCAGCATCAAATC
ACCAACAACTCAGCGCACTATAATTACGACTACTTGAAGG
AGGATCTGAACCTGAACCGACGAGGCTGCCTACAGGCCCT
GCTGGAGCACTACACACAGATCATGCAGTCCATCGGGTTA
ATCGTTCTCATCATTTGGCTTTTTGAGGTGTCTGTGCTGA
CAGGAGTGCGTTATCTTCAGACAGCCATGGAGAACGTGCT
GAGGCAGGGAGACCCTGACTGTGAGTCTGACGGCTGGCTT
CTGGAGAACAGCATTGCAGACACTGCACGCTATAACTTCA
ACATCATTAAGAACCTGGGCAAGTGCTACCAGGTGGATGA
CGATCCCAACATAGACGTACCGAGCACCAGCCGGCAAATG
CAAGAGAACGTGCCCGTAAAGCAAATCCCTGAGGCCAGGT
AGTAAAAGAGACACTGAGACTTACCCAAGCCATTCCACAA
TGGCAGCCTTGGAGAGGCAGATCAAGCTCTGCATTGCAGC
CTTTGACCATTTACTTGAATCGCACAAAGCGCAAAGGAGG
TGAAGAATGACCTGGAACATAAAAACAGGCTGATAAAGGA
GATCTCAATTGAAAGGCACTCATTGCAATGTAATCCTTGT
GCCATACAAAAGGAAGAGAATGAAATATGCATTTTTAGAA
GCTGAAGGAAAAGCGACAGACAGATATTTACAATATTTAA
TCAATCAATGTCAAATTTACTTGGATTTACACTTGTGAAA
TGGAGTAAATTCATTCAACTGACATGAATAAGTTAATAAC
AGCGGCTATAAACAAAGATGGTAATGGATGACAAGCTTTC
GCGTGCCTCTACCCTGTAATGAAGATTATTTTGTCCATCT
TAATATTATCTGAATGATAAACACATTTCAAATTAATCTG
AAAAGGGTTTGATTATAGGCCTTTGTTCCATTACTAAAGA
GGTATTACCATGTGTTAAGCATAAAATGCCTTTTGGGATC
CAGCAAGGATCTTTTTCTCTCTCACTCAGTTGCTTCATTT
GTTTCGTCGTAGGTCTATATTTAGTTTCTCTGCTAGTCAA
TCATACATCTATTGCTTTGGAGAATTTCTGCATCTGAAAA
GGATGAATTTTGGCTTAGGCACATTTTTTCAGACAATTAA
TCAGTACAAACATTGACTTCTGAGCTGCAGCACTGTGTTT
AATATACTTTGAGTCTACACTGTCTGTTTTAAACCCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prph2l-201 Contained in:
OTHER prph2l-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005895 (1)
  • Ensembl_Trans:ENSDART00000010584 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC155639 (1) 1986bp
    CITATIONS (2)