ZFIN ID: ZDB-TSCRIPT-090929-570
Transcript Name: si:dkey-12h9.6-201
Previous Names: ottdart00000005888, si:dkey-12h9.6-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005888 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005888|OTTDARG00000005430|ZDB-GENE-041001-145 si:dkey-12h9.6|OTTDARP00000005270 DKEY-12H9.5-001 LG_ AL954831.17 Danio rerio protein_coding PUTATIVE, 3195 bp
GTTCTCCAGACAGCGCAGATGTACTTCCACGCTTTGCCTC
TGTGTGAAGTTCTCGGGCGTGCGCACATCCACCTCCACTA
ACGCACAAAGCGCTTCTGCTCAGGTTACTGTAAATGAGAC
CTCCAGTCTTACAATTACCTGTTTAATGGACTAAATAGCC
AGTAGGACCAGAAGCCATAATATGAAGAAACGCTACATGG
ATATAGGCAGGCTCCGGAAAATGAAAAAGATTAAACTCAC
TGAGAAGATTTCCGAAAGTGCATACTCTGTTCTGAAGTTC
ATGATCGTCTGGATGATGGTGCTGTTAGCTGACTTTGTTC
TGGAGTTCAGACTGGAATACCTGTGGCCCTGTTGGCTCTT
TCTAGGGACCGTCTACACCACATTCCACTGTCATGGACTG
GCCATCTGTGTGGTTTTTGTGTGTGCTGCATTTACCCTGG
ACTTATTCTGTTTAGTTTTTGTACCCTTACACTGGCTGTT
TTTTGCCGCCAGTACTTATGTCTTACTCAACTATATGTGG
CATACAGAGAAAGGAATCTGTATGTCAACTGTGACATTAT
GGATCCTCTTAGTCTATATGGAGGCGTCTCTGCGCTTGAA
AGAACTCAAAAGCCCTTATGCAAATCTGTCCCATCTATTT
GCTGCACACTGCATTGGTTATCCGCTTGTGTATATGGGAT
TTGATGCAACCTGCTATTTCTCCAGCATGTTTAAGCTGCG
CACTCAGAAATCTGCTCACAGTGAGAATGACCTCCATATG
GATCTCCTGCAACAATCCCTACCTCCTTACATGCACCTCT
ACCCAAAATTGTGGATGGAAGATTCCAAATATAAGATGTC
CAAATCCAGGCCAACGCAATACCAGTGTCCACCTGATACC
ACCACCTCAGAGGACAAACACAACATGGAAGACTGCCTTC
AAATCCACAGACTTCCCTCCAGACCTGAAAAAGACCTAAA
TCCACAAACTCCAGCATCCAAGCACCGCGGAGGCGAAATT
CATTTAGACTCCACATCCATCCTAGAAATGACTGAAAACC
TACCTCAGGACGATCAGAGCAGCAAAGCTCTAAGATCCTC
CAAGAGCTCTCTGCCTAAAGTGCAGCGAAGCTCAGTGAAT
GTTCCTAATGGCAAAGCCGAGAAGAGGCAGAAAAACCTCA
AAGCCATCAACTCCACAGGGGAATCTGTTGAACGGTGCTC
GTCAAACATCCCAACCCACAATCCTCCACCAAATCCTTCC
AACCCACATGCTGAGCAGATGCTGAAGCTGGAACAGGAGC
TGAGAAAGCTGAAGGGAGAGCTGCAGGCGAGCAGACAGAG
CGAGCAAGAGCTGCGCAGTCACATTTGTAATCTCACCAAC
AGTGAACACAGTCTGCGGCCTGAAGTCTCTCTGCTCAGAC
ATGCAAATGAACTGCTGCAGAACAAGATTCAGTGTCTGAG
TAAATCCAGACAGAAGGACAAACAGAACTGTTCCTTGCTG
GAAAAGAAAATCAGAATGGAAACAGACGCCCGAGTTGTGG
TAGAAAAACAGCTCACAGAAGTCAGAGCCCAAAAATTTGA
TGAAGCAACGATTTTACTTCGGAGCGCATCACACAGGCAA
GAACAAAGTGAAACTCAAATGTTGAGGAAAAAAGCTAAAG
ATCTAGACTCAGAGTACAAACAACTACAGCTGGAGTATCA
GGGGAAAGAGAATCGAATGATAGCTCTAGAGAATGAAGTG
GAGACTCTGCAGAGGAACAGATGCAGTGAGCAGGAGGCCG
ACGCTCTGCTCTCTGCTCTCTCCTCACTGCAGGACAAGGC
TCAGCATCTCGAGTACAACCTGAGTGCAGAAACCCGGCTC
AAACTAGACCTGTTCTCAGCCCTTGGAGACGCACGCAGAC
AGCTGGAGATAGCGCAAGTTAAAATACTGAAACAGGACCA
TGAGGTGAAGGAAATGAAGCAGAAGCTTGCTGAGGCGATG
GCTGTGGCTCCAGGTATGTCCTATATGGCCCCGAGGTCCT
CCATGCCTCAGTACCTCAAGTTCTTGAACTCTGAGCGCTA
CATGCTAAACCCCAGAGCGCTTATGTACCAGTGTCTGAAG
AAGTAAGAGCGGCAGGGACAAATCCCATGGCTTTTCAATG
ATTGTTGTGACTCGACATTCCAAACATGAGGGCATCTCTG
CTTCAAGGTTTGCCAGAAAACTTTGCCTTTTGACAATGCC
AGCCGCCTCTGGTGAGTCTCCGGCTGTGTTTACTGAATTG
AGCAGAGGCACTGAGGCCGCTTGTAGGTGACTTTGCTTCA
AGCCAAGATTTAATCGAATCAAAGTTGACTGTAAATAAAT
TGTTGACCAGCGGATGACCATCGAATGCTGAGCAAACCAC
TGCGAGCGGCGCAAACCGCTCAAGATATCAGTATGAAAAA
AACTTGATGAGGAGCACAGTTCGTCATGAGGACAGGATCT
CCTGCAAAATGAAGAGGCTCTTCTTCAGCCATGACAATAA
CAGGCCAATGCCTCACTTGGTCATTCTGTGCCTCATTATT
TATGTGAATTCAATTTATACAACAAGCCAATATCAAATGT
AAGTCAGTATGTGAATATTCGAGTGCTTTGTACTGTTTTG
TATTCTTTTTACATTACACAAGTTAAAACAGAATTGAACA
GCACACAAACACACACACACACACGCACACATACACACAA
ACTAAGAAAAAAACGAAACAATATTTGTAGGTTTTCATGT
TTCTGAAACCGTTGCCTTTTTTATGTATCAATGGGATGTT
TTTTATGAGAAGTTTATTTTTCTGCCTTGACATAACTTTT
TTTTCCTAAACCAAAATTAAATAATGGTTTAATTTTGTAA
TAATACTTGTTGGTCTGCATGCCAATTTGTGTAAAATGAT
TGTTTTGGACAAAAAAAAAGAAAAAAAAGAAAAGATTTTG
ATGTCTAATTGTGCTTTTGTGCAAGGGCTGTTTTCTTCCA
ATGATTCTGGGAGCAGTAATAAAGTCATTTACAATGATAA
ATGTGTATTGTCTTAAAATGTTTTTTTAGAGACTTAAAAG
GTTAGTTCATCTGTCATCATTTGCTCACCATCATTTCATT
TTTTAAACCTATTAAGCTTTTGTTTATCTTCAGAACAAAT
ATTAATATATTTTAATAACATCCGAGAGGTTTCTGTCCCT
CAATACAAAGTAATTCAAATAAAACTCAGAATGTA

si:dkey-12h9.6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-12h9.6-201 3195
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-12h9.6-201 Contained in:
[BAC] DKEY-12H9 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000005888 (1),  Ensembl_Trans:ENSDART00000140255 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB858022 (1) 553 nt
GenBank:EB773847 (1) 488 nt
CITATIONS (2)