Transcript

inhbb-201

ID
ZDB-TSCRIPT-090929-5589
Name
inhbb-201
Previous Names
  • inhbb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022182 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022182|OTTDARG00000018304|ZDB-GENE-990415-2 inhbb|OTTDARP00000018601 inhbb-001 LG_none BX664716.19,BX927396.13 Danio rerio protein_coding KNOWN, 3022 bp
GGACAACATCCCTCCTGAGGCTGAAGAAACGCGCAAGAAC
TCGCAACACTACATTACTAAAAGAAGAGGAGCACGAAACA
ACTCGAATTCGGTGGACAGACAAACGGTGAATCGTTCTCT
TCAAGCAAGATTTTGTTTTTGACCACACTGAATTTTAAAG
GAATAGCAATCGGTTTGTTTTGACTCTTCACACATCAGTT
AGTCCTGTACCTTGATGATGAGGAGACATTTTCGCGCTTT
TTAACTCGAGGACTGACATTTTCGCGACAAGATTTCGCTA
TTATCAATGCGTTTACCGGACGATACTATGAACTCTTTCT
ATGAACGTCTCACAAAAATGACCGCGAGCCTAATAATGAA
CGGACATCTGTCAAAGGAGGTTGCTGGAAGTACAACTCAG
TCCTGTTTATAGTTTATTTTAACTGTAGGAGTTCATGAAC
TGATTTGTTTGTTGTATGGACACGATATTTATGAAAATGA
GCGTTTCCATCCTCTCTGTAACCTGTTTGATGGCTTGCCT
GCTCTCGGTTCAGTGTAGTAGTCTGGGAGCGGAGACCGGC
TCCCAGGAGTCTCAGTGTGTGTCTTGTGGACTCGGGCATC
AGGAAGATTCGGGGAGAATGGACACAGACTTTCTGGAAGC
GGTTAAAAGGCACATATTGAACCGACTGCAGATGAGAGAG
AGACCAAATATCACTCATCCCATTCCCAAAGCCGCCATGG
TAACGGCGCTGCGCAAACTTCACGCGGGTAAAGTTAGGGA
GGACGGCAGGGTTGAGATCCCCAACTTAGATGGACACGCT
GCCCACAACGAGGTGCAAGAAGAAACGTCGGAAATCATCA
GTTTTGCCGAATCAGATGATGTAACTCCATCCAAGTCCAG
CCTCTACTTTCTGATCTCCAACGAGGGGAATCAGAACCTC
TACGTGTTGCAGGCAAATCTGTGGCTGTATTTTAAGCTGA
TGCCAGGTACTCTGGAGAAGGGCCTGCGGCGAAAGGTGAC
AGTGAGGGTGCACTCCTATGAGCCTGGTGGGCAGAACGTG
CACTGGCCCATGATGGAGAAACGTGTTGAATTGAAACGTA
GCGGCTGGCACACCTTCCCTGTGTCTGAGGCCATACGGGA
AATGTTGGCTAAAGGAGGTCGCCGACAAGACCTCGACATC
CACTGCGAGGGTTGCGAGGCCGCCAATGTTCTGCCCATCT
TGGTGGACCCAAGTGACCCCTCTCACCGACCCTTCCTGGT
AGTCCGGGCACAGCAGGCAGATGGAAAACACCGCATCCGA
AAGCGAGGCTTGGAGTGTGACGGCAACAACGGAGGTTTGT
GCTGCCGACAGCAGTTTTACATCGACTTCCGGCTCATTGG
GTGGAACGACTGGATCATTGCGCCAGCAGGGTACTATGGG
AACTACTGTGAGGGCAGCTGCCCTGCTTATATGGCAGGTG
TTCCAGGCTCTGCCTCGTCATTTCACACAGCAGTGGTCAA
CCAGTACCGCATGAGAGGCATGAGTCCCGGATCTGTTAAC
TCCTGCTGCATACCCACTAAACTCAGCACCATGTCAATGC
TCTACTTCGATGACGAGTACAACATCGTCAAACGTGACGT
GCCTAACATGATCGTGGAGGAGTGCGGCTGTGCCTGAACA
AAATCCATGTTAGGACAGCAGTGACAGTCATATTTATGGT
CTTTCTGAACCACATGCATATAGATTGCGTTAATATTTGT
GCACTCACAAAGTACAATCACACACGTCTGTATGTGTGTG
TGTGTGTGTGCATCAAGCAGTAGATCATCAGACAGGTGGA
TATAAAGGCTAGGGATGATAAGGGAAAGGAAACACCAAAT
GGTTGAACTCTAGTTTGCCATTTCTAGACTTAAAAAAAAT
GGCTCAAACTTTCTAACAGCGAACTGGTGTCATGCTTTGA
CATGAGTACTTAGAGACTGTTGTACAAGCACTGACATATC
TCAATGTCCCTCCTACTTCAGAACACCAGCACTTCCAACA
GCTCATATAAGGCAATATGACAAATCATTCCAGCTGATGT
AGAGATTTCTAAATCAGTGCGCATCATCCCAGTCCTTCTC
AGAGGCTTTCCCACAGCAATGACTCCAGCTGTCTGCGCTA
TTGTCAAATAAATAGTGAGGCTTCAACCCAGACTGCAAGC
ACCTTTGGCCAAGATCATCTTGAAACTAAAACCACTTCCA
TCGTTCCACTTAACTTAACTGTGGCTGACTGCATAACAAG
ATCTTGAGGTCTAACCGGTACAGCGCAAAGTTCACCTGCA
CACTTCAGTGGCTGACAAACGCTTGCAGCGATGTGCGTTC
CACAGAGCCTCTTTTACTCTGTCCAGCTGGTTTACAGGGA
GTACAGCACTTGCGAAAACTCTCGAAATGCACAATTTAAA
GCACTTGCATATTGCAAAGCCTTCAAAAGGGTACAACGAG
GTGGACCTACCCTTGCCCATAGTCCTTTTAATATAAAGTG
CCGCACGAACTATGCAATGTATAGTAATCCTGAACAATGT
CAAACAAACTGAAATCTTCTTTCTGCTTGTCTTTAACTCT
GTATCAATACTTGAAATGTGATCTTTCGCTTGCTTTCCAA
AGCGGATGATTGTTACGATGTTTGCACTGAAAAGTTGCGG
GATTAGTTAAAAGACAAAAAAATAAATCTGCCATTGAAAA
TGTTATTTTTGTAGTAAAACTGAATATTTGTAAACAACAA
AAAAAAAATTAATTGTACCAAAGAGGCCAATATTTTAGCT
ATTGTAATAAGGTGGCAAGGCCATTCCAATATTTGTAAAA
TAATTGTTGATCCTTCTCAAGAGGCCTAATAATCAGGGTA
CAACATAATGGATTCCATTTATAGCTCTGTCTAATTTTTG
TATGCCATGTACAGAAAACCGATGAAACACAATCTTTTCC
TTGTCTTTAATTTTCCAGTCTTCTATTTAATAAAAGTTAT
TTCTTAGCTGTTGTCATTTAGTTCAACGGATGTCATCTCT
GTACAGATTATGTAAAATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations