Transcript

gsto2-201

ID
ZDB-TSCRIPT-090929-5518
Name
gsto2-201
Previous Names
  • gsto2-002
  • zgc:101897-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022098 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022098|OTTDARG00000018257|ZDB-GENE-041114-67 gsto2|OTTDARP00000018554 DKEY-51A16.3-002 LG_ BX530079.19 Danio rerio protein_coding KNOWN, 1041 bp
CTCTTCAGCCACACCTTTCCTTCTATAAAAACTTCACTTC
CACTCCTCTCAGCTTCACGGTTGACAGGGATCAACAGTAC
GACTCTTCTGCAAGAGAACACTTCGACCACTACAATGGCT
TCATCTCCAAAATGCCTCGGAAAAGAATGTTCTGCTCCTG
GACCGGTGCCGAATGGTCAGATTCGGCTCTACAGCATGAG
ATTCTGCCCTTTTGCTCAGAGAACCAGGCTGGTACTCACT
GCCAAGGGAGTGAAGCATGACATTATCAATATCAATTTGG
TAAGCAAGCCTGATTGGTTTCTGAAGAAGAATCCTTTTGG
GACAGTGCCAGTGTTGGAAACCTCCAGTGGTCAGGTAATC
TATGAGTCTCCGATCACCTGTGAGTACCTGGACGAGGTCT
ATCCTGAGAAGAAGCTGCTCCCGTCTGACCCGTTTGAGAG
GGCTCAACAGAAAATGCTGCTGGAGCTTTATTCAAAGGTG
ATCCCATACTTCTACAAGATCTCTATGGGCAAGAAAAGAG
GAGAGGACGTCTCAACAGCTGAAGCTGAATTTACAGAAAA
ACTTGTCCAATTAAACGAGGCTTTGGCAAACAAGAAGACC
AAATATTTTGGGGGAGATTCAATCACAATGATTGATTACC
TGATCTGGCCATGGTTTGAGAGGGCAGAGATGATGGGAGT
GAAGCATTGTCTGGCCAAGACGCCTGAGTTGAGGAAGTGG
ATTGAACTCATGTTTGAGGATCCAGTTGTGAAAGCCACCA
TGTTCAACACCGACGTCCACAAGGTGTTCTTCGACAGCTA
CATGGATGGAAAACCTAATTATGACTATGGTTTATAGATT
AAAATGCACTGCTGTCGGTCTATCTATGGAATGTGTATCA
TTACATCTTTCTTTGTCTGTATATTTCGACTGAATTGACA
GCAAATTTAGCTTTTAAGCCTAAGACCTGAGACTAATCAT
GATTTTTTTTAATTAAAAAGGCTACAATGGGTATATTAAC
ATGAATTTAAATAAACCAATGTATAAAATATATGGACAAA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations