ZFIN ID: ZDB-TSCRIPT-090929-5496
Transcript Name: abcb10-202
Previous Name: abcb10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022076 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022076|OTTDARG00000018242|ZDB-GENE-040525-2 abcb10|OTTDARP00000018536 DKEY-162B3.3-001 LG_ CR762497.17 Danio rerio protein_coding NOVEL, 2454 bp
ACACTGGTCATCTGACTATATACGCGAAGTTTAGACAGAT
GATGATTAGTTAGAGACTTGTGATATTCATTTGGTTTCGA
TTTTTCTTTAAATGTATGGGACAATGTTGCGAATGACAGG
ATTTGCTATCGGGAAACTGCAACAGTGTAGCATTACCTGC
TGTCGGTCAAGTACTTTTCATCACTGGTCAACCCGGACAT
CAAGAACGTGGAGCAGGCAAGTGCGCAAAAATGGATCGTT
TGATATCTGTGTGTTGCCTGTGTATAAGGGAAGAAACATA
TCCAAGCTCTCTTGTCTTAGAACTGAAGGGTTATTTTCAC
CTAAGCACTCCAGACACATAGTTGCTCTCTATAGCACATC
TACAGACTCAAACCAAACCTCAAAGTCTGTGGTAAATCAG
GAGAGCAGCGCGAAAACCACAGCGGACTCGTTACCTGTTC
CCTCGGAAGATGTCAAGAAGCTCCTTCAGCTGGCGCATCC
GCAGAGATGGAGACTGACAGTATAGCTGCTGTGGGGTTTC
TGGTGATTTCCAGCACTGTCACCATGTCTGCACCCTTTTT
TCTGGGAAAAGTGATCGACACCATCTACACCAGCCCCACC
GAGGACTTCAGCTCATCCCTCACCTCTCTCTGCCTCATGC
TGACAGGCGTCTTCCTCTGCGGAGGCGCTGCAAACGCTGC
TCGTGTCTACCTCATGCAAATCTCAGGACAACAGATTGTG
CGAAAGTTGCGCGAATCCCTTTTCTCCTCAATTTTGAAGC
AGGAGTTGGGATTCTTTGATAAGACCCGAACCGGTGAACT
TATTAACCGGCTTTCAGCAGACACAGCTATTGTTGGACGC
TGCCTCACTGATAACCTGTCTGATGGGCTGCGTTCCCTGG
CTCAGGCTGGAGCCGGAGTTGGCATGATGTTATACGTGTC
ACCCAGTTTGGCAGCTTTTGTGCTGATGGTGGTTCCTCCT
ATTGCTTGCCTGGCTGTCATTTTTGGTAGATTTCTACGAT
CCATATCGAGACGCACACAGGACGCATTAGCAGAGGCCAC
ACAGCTGGCAGAAGAGAGGATCAGCAACTTGCGGACAGTC
CGAGCTTTTGGGAAAGAGCTGACAGAGGTGCAGAAGTACT
CACAAAAGGTTGACCATATATTCGAACTAGCCAAGAAGGA
GGCTGTGGTTTCTGCTGGATTCTATGGAGTGACAGGGCTG
AGTGGAAATGTCATCATCCTGAGTGTGTTGTATAAGGGAG
GTCTGCTGATGGCCAGTGAGGCCATGACTGTTGGGCAGCT
CTCGTCTTTCCTCATGTATGCCTTCTGGGTAGGCATCAGC
ATTGCAGGTTTCAGCTCATTCTACTCTGAGCTGATGAAAG
GTCTTGGTGCTGGTACTCGTTTGTGGGAACTCATAGACCG
AAAGCCTGAATTTCCCCTCAATGAGGGGCTTGTACTAACA
TCAGAGCTGTTAAAAGGAGAACTGGAGTTTCGTAATGTGA
GTTTTGCTTACCCAACGAGGAAGGATTCCCCCATCTTCCA
GGACCTAAGTCTGCATGTGCCGGCAGGGTCAGTATTGGCA
GTGGTGGGATCCAGTGGCTCAGGCAAATCCTCACTAGTCT
CACTGTTGCTGCGGTTATACGATCCCGATTCAGGTATTGT
CAGTGTTGATGGTCATGATATTCGAGACTTGAATCCTTAC
TGGTTAAGGAGTCACATTGGTACTGTAAGCCAGGAACCGG
TCCTTTTCTCCTGTTCAATTGCTGAGAACATTGCTTATGG
AGCGCCGGATCCGAGTCAGGTGACAGTGGAGGACATTTAC
AGGGCGGCACAGATCGCCAATGCTCATGACTTCATCCAGG
AGTTTCCCAAGGGCTACGATACTGTGGTGGGAGAGAAGGG
GGTTCTGCTGTCAGGTGGACAAAAGCAGAGAGTGGCCATA
GCACGAGCCCTGCTGAAGAATCCCAAAATACTTTTACTGG
ATGAAGCCACGAGTGCTCTGGATGCAGAGAATGAGTTTTT
GGTCCAGGAGGCGTTAGAAAGGCTGATGGACGGCCGTACA
GTGTTGATCATCGCTCATCGTCTCTCAACCATCCAGAGCG
CAGACTCTGTGGCAGTGCTAGACCAGCACCGTGTGATGGA
GATCGGCAGCCACTCGCAGCTCTTAGCTAATGACCAAGGA
CTCTTCCGCAAACTCATGGAGAAACAGGCCTTCCTGCAGG
CCGAGCAGAAACAGGCGCTCCTTAAATAAGAGAAAAACAA
ACATTCAAACACATTATAAGTCTCTTTACTGAGCACTCCG
AGAAAAAAAAAGAAACACTGAAATGTAGCTTTTTAGCATG
TGCAGTATCAAGTAACTGGAAACCAGTTGTATACTGATCA
TTGTTATTTACAGTGACATAATATAATACTCATCTGAGTT
CCATAAACACTGCTTTTTATTCAGTTGTTTTTATGCTTTC
ATAGCCTATGGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abcb10-202 Contained in:
[BAC] DKEY-162B3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022076 (1),  Ensembl_Trans:ENSDART00000135992 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK683984 (1) 857 nt
GenBank:BI887124 (1) 761 nt
GenBank:CK699312 (1) 732 nt
GenBank:AI666988 (1) 589 nt
GenBank:AI666987 (1) 588 nt
CITATIONS (2)