Transcript

urb2-201

ID
ZDB-TSCRIPT-090929-5494
Name
urb2-201
Previous Names
  • urb2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022074 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022074|OTTDARG00000018241|ZDB-GENE-030131-2621 urb2|OTTDARP00000018534 DKEY-162B3.2-001 LG_ CR762497.17 Danio rerio protein_coding KNOWN, 5161 bp
GTTTATAATTTAGGGTATCTTACATTCCTCTAAATGTGTC
CACCAGTGTTTAGATATAATGTTATTATGTTAAACTTTCT
GTAAATGTCAAACTACTTTGGTCACAATTTATTTCAACAG
TTTAGCAAGCCAACAGTTTATACATTACAAATAACTTCTG
ACCGAAACAAATCATACATCTTCAAAAGTTTCTCTAAAAT
GAGCGAACCAGTTTTACACACAAGCGTTGATGCTCCTTTT
CGATTATTACTGTCTTGTGTGAAAGTGGAGAGTTCAGAGG
TCCCCACAGCGGTAACACGTGTGTCATGAGATTACACAAA
CATATTTAAAGATGGCTGCCATTTACTCTGGCATCCAACT
GAAACTCAAAAACACCCGAACACCCTGGCCAGACAAACTA
AAACTTGCTCGATTTGCATGGATATCAACACAGTGCCTTC
TTCCTAATAAAGAACAGGTTCTGTTTGACTGGACAAATCA
TGCTCTCACTTGCTTTTACAATAAGAAAGTGGAGATGCCT
CCAGAGGTGGTGGAGGGTTTATGGACCTACCTTGATGATA
TCCTTCACAGCAGGAAGCTTCATAATGTGCTGAGTCAAGG
AAAAACCATTAGCCTTCGTCTCACAGTAGCACAGATAATC
AATGACAGGATTTTGGACTATACTTCAGGACTCAGATCTG
TCAGTTTCCACACCATTCTGAGCTGTTGCCATGGTATCTT
GACCTCCCCGGTGCTCTCTGTTATCTACACTGCTAAGTAT
GAGTTATTAGTGCAGCTTTTGTCTCGACTCTGTGGCTTGA
CCAGCATGCAGCTCAGACAACAAAAATATGAGGAGCCTCT
CTCACTCAAAGCCTTTGAGGTTCTTCTTGTTGTCCTTAGC
AATTACCTTACAGTGCAGAAACAGCAGGCAAACTCCAACC
GAGTGTTTTTCCAGGTAACGGCACATCTTCTTCATCCGCT
ACTCCTCCTCAGACACTTACTGAACACTAGAGTATGGACC
GAAAAAGATGATGTCAAGATTCGACAGAATCTGAGCAAGG
AAATACGGACCAAAGTGGATGCTGTTCTCCAGTCAGCACT
CTTCCTTTCTGATCATTTACAATCTTACAAGGTAGAAGTT
TCACCATCCGAGAATGAAGCTGGGGATAGAAAGAGCCATA
TAGGAAAAGGCTTGCAAGGCCCTCTCAATACAATCCTTAC
AAGGATTTGCATCCATGGAGCTAGCGAAGAGGAAGAGGCA
CTATTTTATGCCGTTAAATCAAACTCTCTCTCATTGCTAT
TTAAATTTGCCCTAGATTCTTTTTGTAGAGGCGGAGAGAA
CAAGCGAGTGATCTTTCACCTCATGGCAAAACTCATTACT
GCTTTGGGGTTCACAGATGAACTAGACATTGATGAGAATT
TCAGAGCATCAAACTGGGGTATCTGTTTACTCGCTCTGGA
GAACCTCCTGAACTCCTGTTTGGTCGGTGATATCTATAAT
GTAGCTGCAGACAGAATACAACACGGAGAGGTGCAATTCA
ATTTCTACAGGAAAGTGGCTCGCCTATTATTTAACAATAC
ACAGATGGGCGTCCCAGCTTGGTACCGCTGTCTCAGAGCT
CTGCTCGCACTGAATCACCAAATCCTAGAGCCAGATTTAG
ATGAGCTTCTCTCAGCTGTGTGGGTTGATGCAGAAAACAT
GGAACTACGTGTGAGGAAAGCCAGAGAAGCACTTGTGTCT
GCCGTCTTGCAAACTTATTCCAAACTCCGACAGCTGCCTA
AACTTATCGAAGAGCTGCTTGATGTAGTGTGTCGGCCTGC
AGCAGATGAGTTGAGACCAGCTTTGTTGCCGGAAGCGATA
CAAAAGACCCTGAGTCAGTGTTTGCTAGACAATCCTCTCA
GGCAAAATCTTGAGATCTGTGGGCTCATTTTAAAGAGAGT
GCAGTCCTGTCTGCTTCCCCACATTCAAGATGAAACATCG
GATTTGGCACTGAAAGTCTTTTCTATGAGTTTGCTCCTTC
ATGCTGTGCTCTTCAGTTTTAAGACTTTGGACAACAGCAC
CCCTGTGCCAGTTGTAAAGCAAACTCTAAGTTTGATGACA
GAAATGCTAAAGGTTGTTGAAGATTTGTTGGAGCAGAAAC
TTGCCACAAAAGGTCCTTGGATGGAGAAGGTTCAAGAGGT
GACTCTTCTGCTTGCTCATACTTGGGTTGAGGCAGATGCT
CTCTTTCAAATTCACTGTACTAAGTACACATCACCTTCTG
CCTCTCAGAGTAGCACTTTAGTGGACAAAGCTCTGATGCT
AAGGAACATGGACAGTCCACTTGGTAAACTATTACAGAAT
CTCCTTGCTCTCCACAAGCTGAAGATACACTTGCTCAAAT
CATTCAGTGAATCATCAGAGATGCAGAAAATGGCTCAGTT
TATTCTGAACAGGGAAGAACTTTCAGTAATACACAGCCTC
GACCAGATGTGGGACTTTCAGTTTTGTAATGTGAATTCCA
GCACTTATAATGCAGCCCACTGGTTTCTTGTTACCTCCAA
CCTTCCATTAATTGCCCCTTATCTTGATCCAAACGACAGG
TCTGTTTTTGCAGAATGTATGTTAAAGTCTTTGCTTCAGA
GCTTGGATGCCTCTGGAAGCAATTTGGAGAACACTGGGAT
CTCTGTCTGCTTAATATCAAGACAATTACTGGAGAGTCCT
GTTCTTTGTGAGCTCCCTGAGATTTTCTCAGCGTTGACGA
AGTGCATCATCAAGGCGTTGTTTGGACTGCTCGACTCATC
ACACATGCAGCTTATTTGTCCTTCATTTTTGACGCCTCCT
GTAGAAAACGTTGAAGTCAAAGATGAAGAAATGGGCATGA
CACCTTCTATGAAGAGACTCAAAGCTATTGGACTGGAGAT
GTTGTACTCTGTCAAAATGAAGTCTTCTGTACCTCTATCT
AAAAGACAGATAAATGGATTACTGCAGCTAGTCAAAGTCA
CAAGTGTCCTGAATGGATACGCAATGTCCTATGAAGACTA
TTTAGAACTTTTTCTGACTTTGTTAACACTGACGTCCACC
ATTCAGTGTGTTGAAGAAACAAATCTCTCTGCATTTATTG
AGTTACTCAAAGAGCTTTTTAGTGTCATGGCTTCACTCTT
GCTGGCCAAAAACTCTCAAAGCATCCTGAAAGTTATTCAC
GGAAGTAATCTCTTAGAGGCAACAATGACAACCCTTTTCT
CTCGGAGCAGCGAAGGCCTCTTCAAGAGTTTGGATGGTCC
GACTTGGTTGTCTTTCCTTCAGTCAGTTCAAGATTTCATC
CAGTCCCTAATTCGGCTTATAATCGACAGGAAAAGCAGCA
TATGCCTCAATCTGGAGAAATTTACCTCCTTCATGGTTGA
ATGTAACTTCACAGCAAGAGTTCTGACTGTAGACACGGGA
GATCTCTTCTCGCTGCAGCTTCATCTGGTAACTTTAAGCG
CACTTTGCAGAGAAATGATGACAACCCTCGGCAAGAACAA
ACAGCTGGACCAGGCCCTGACTCACTTGTTAGAGAAAGCC
ACTGCTGTCATGGAGCCAGCCATTCAGGCTGTGTTGATGG
GCAAGGGAAGTTGTCTCCTCAGGCAGTCCTTCTCTGTTGA
AGTGGTAACGGTCATGATCAGGTGTGAACTAGCAAGAGCT
TCAAGCTCTAACGATGACGGCCAGGAAAAAATATCCAGTA
TGCCATTCTATAGGAGCTTTTACCAGCAGATCTTAAAAGA
GCTGTTCCCATCACCTCGTCCTATGGACTTCCTCATTTCA
TCGATTCACTATCTTTCTGCATTCCACATGGCTGCAGAGA
AGACCAAAGTGGCAGATCTTGAAGATCTTCATATTGAGAT
TTTGCAGAGTATCCAAGCGCTGCTGTCAGGAACGTGGATG
TCTCTGACAGACGTGAAAGAGCTGGAGGGTCCAGTGAAGG
AACTGCTTAATCAGCTGATGTCCAACTGTTCTCAAGAGCA
GTTCCATCTATTTCTGCTGATGCTCAGAGAGGGGCTTGTG
GCAGCCAAGGTTGAAGGAGGCCAATGCTCTGAGGTTCTGT
CCGCAGTGACTTTAATAAAGCTGCTTGCCTGTTGTCTTTT
TCCAGAGCATTGCTCAAAGGCTTTTTGGCTCATCACCCCA
CAAATAATATCCAGCCTCATTTTCATAATAAAGGAATCCA
GCAAACTCCCCTCTCTGACCCGTGTGCTGACAGTACCAGG
TCTCGAGGCTCTGACCGTCTTGCTCCGGCAGGGTAAAGCA
CAAATCTCCAACCCGCACCAGGTGATTGTGGTTTTGGGCG
CACTGCAGTTTGTGCCTCTCGATAGTCATTGCATGGAGGA
CTATCATTCTGCTTTTGAGGCCGTCCATGAAGCTCTGTTT
GCAATTATCCACTGCTACCCTCAGGTAATGCTGAAAGCTT
CTCCCACCTTCCTGAATTGCTTTTATCGCTTAGTTTCTTC
AGTCATGCATGAAGGGAAACAGCGGAGTGACACTGACAGA
GCTTCTGAGAAAGACAGAGAGAGTCTTCTGAAGTGTGCTA
GGCTGGTGGAGAGGATGTACACTCATGTTGCCAGTGCTGC
TGAAGATTTCACTGTCCTGTCCTCCTTCATGGTCGCGCAA
TACGTCAGTGAACTGCAGAGGGTGACGCTTCAGCCAGAAA
TCAAGGCACATCTAACAGAGGGAATATACTGCATTCTGGA
CCACTGTGTTGAACAAGACATCAAGTTTTTGAACACCACC
CTTCAAATGGGCGTCAAGGAGGTGTTCAATGAACTGTACA
GTAGTTACACACACTATCACAAATCTCAAAGACAAGGGGA
AGAAAAGTACACTGTTTGATAGTTATATTTAGTGCCCTAA
ATGTGTCAAGGAAATAAACCTATTTTGTCTTTTTACTTCT
GATTAATCTCTTATAGTTCTTAAATCTTAAAGATGGTGAT
AAAAACAGTTGTAACTTCATCCAAAAACAAAAGTTGACAT
TATTTAGCTGTGCGTATGTTTTTTTTTTTTTTTGCAAAGC
TTTCTTTTGTGTAAAATAATACAATATATTTTATCCACTC
TAGAAAATGCAGTAGCTCTGTTGTTTAATTTCCTGTGTTT
TTAAAAATATCATTTTCTTATTAAAGAAAAAAGTCATACA
GGTTTGAAATGCCATAAGGGTAAATAAATGATGACCAAAT
G

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations