header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5468
Transcript Name: rab23-201
Previous Name: rab23-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022026 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022026|OTTDARG00000018211|ZDB-GENE-050522-328 rab23|OTTDARP00000018503 rab23-001 LG_ BX004843.10 Danio rerio protein_coding KNOWN, 1521 bp
GTATTTTGAAAGTTCTCTAGTGGTGGTCGACGTATCGATA
TGCCAGAGTCTCCCGCTTCCCGCAGCCGCCGCACCGTTTA
ACGGCCCGCCAACCGACAACCGGACACTGTCTCCGTTCAT
CCCAGCACATCCATATCCCGGAGCCCATTTAACGGTGAAT
TACCGGTCTGTAGCGGCTCTAAGACGGAGAGAAACGGACG
GAGGAGGAGGCCGCCGCCGCTCCTCCGCTGAACAGCGGTT
TCTGGATTTCTCGCTCTCATAAACTGCAGGCTCTGCTGAT
CATCATCTGGTTTTCGTAATTAATATTCTCCTGTCGATAT
TCAAGATGAAACAACGTAACCTGGAAACACTAACACAGTT
GTGAAGAGCAGCCGTCATCACAGCGCAGTCATGCTGGAGG
AGGACATGGAGGTGGCCATCAAGGTGGTGGTGGTGGGAAA
CGGAGCGGTGGGCAAGTCCAGCATGATCCAGAGATACTGC
AAGGGCATCTTCACCAAGGACTACAAGAAGACCATCGGCG
TGGACTTTCTGGAGAGGCAGATCATAGTGAACGGCGAGGA
CGTCAGACTGATGTTGTGGGACACGGCGGGGCAGGAGGAG
TTTGATGCCATCACTAAAGCTTATTACAGAGGAGCTCAGG
CCTGTGTGCTGGTTTTCTCCACCACCGACAGAGAGTCATT
CGAGGCCATCAGCAGCTGGAAGGAGAAGGTGGAGATGGAG
GTGGGCGACATTCCCACTGTCCTGGTGCAGAACAAAATCG
ACCTGCTGGACGACACCGTCATCAAGAATGAAGAGGCTGA
AGGTCTTGCTAAAAGGCTGAAGTTGAGATTCTACCGGACG
TCAGTGAAGGAGGATCTGAATGTCAATGAAGTTTTTAAGT
ATCTAGCTGACAAATATCTGCAGCGACTCAAGCAGCAGTC
AGCGGAGGAGACGGACATCATTCACACATCCAGCAATAAA
ATAGGCGTCTTCAACACAACAGGCAGCGGTCATCCAAACC
AGAACAACAGCGATTTGAATGGCAGAGAGATCGTAAACCT
GCGACCAAACAAGCAGCGGACGAAGAAAACGAAAAACCCC
TTCGGCAGCTGCAGACTCCTGTAGAGCCCCACACCACAGA
TGCATTGTGGGCTTCATTCACGCTAACTGCTAAAGTCATG
TTCAGTGCAGAGCAGGTCTGTCATTGTGTGTGTGTGTGTG
TGTGCGTAGGTGTGTGTGTGTGAGTGTGTGTGTGTTGGCG
CTCTCTTCTGGCCACACAGAGAAAAACACTAAGAAAAAAG
ACTAGATTGTGAGTTTTTGCACGGATAGAGGCATCAAAAC
TGACCCCATAATGAAATCTAATATGCATTAGTGGCTCAGA
AATGATCATGATCCTGAAAATCGAATCTGCAGTGAGCGAC
GGCGAATCTGAGGTCTGTTCAGCTTATTTTTGTATTGACC
TGTAAATCTGTCAGACGCTGCCCTCGCTCACGTTTTAACA
AGTCAACACTTAATTAAAAAAGCGAATCTATTTTTCTCAC
A

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rab23-201 Contained in:
OTHER rab23-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022026 (1)
  • Ensembl_Trans:ENSDART00000019983 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL911854 (1) 539bp
    GenBank:AL911855 (1) 484bp
    CITATIONS (2)