Transcript

adgrg7.2-201

ID
ZDB-TSCRIPT-090929-5434
Name
adgrg7.2-201
Previous Names
  • adgrg7.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021949 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021949|OTTDARG00000018155|ZDB-GENE-060503-46 adgrg7.2|OTTDARP00000018449 CH73-162I18.2-001 LG_ CR956626.9 Danio rerio protein_coding NOVEL, 481 bp
ATGATATTCATAAAGGCCTCTAATATTATAGGTTTGCCTG
CTGCTATTGTTGGCGTCTCGCTGGCCACAACTTACAGATT
TAAGGACCCTTCAGGTTATCGACAAGAAGAGTTTTGTTGG
TTGGCCTCTTTGGACAAGATGGGAAAGTTTGATCCAAAGC
GGCCGATGTTGTGGGGATTCTTGCTCCCTCTAGCGGTCAT
GTTGAGTTTTAACACATCTGTACTTGTCTACTTCTCTCAA
ACTATCTGCTGTGCAAATCCCAACCTGAAGAGCTCACGAA
GAACTCCTTTAAAGAAGAAGATTTTGAGTAGTTTCTCTCT
GGCTGTGGTGCTTGGTTTGTCTTGGGTCATTGGATACTTG
GTGCTCATAACTCGAGACAAAACACTTTACATCATTCTCA
GTGTCATCTTCTGTCTCTGCAACACAACACAGGGTGTTCA
GATTTTCATTTTATTCACGCTGATGTCATACCTAAAGACA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations