header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5433
Transcript Name: jagn1b-201
Previous Name: jagn1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021948 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021948|OTTDARG00000018154|ZDB-GENE-040801-103 jagn1b|OTTDARP00000018448 CH73-162I18.3-001 LG_ CR956626.9 Danio rerio protein_coding KNOWN, 1615 bp
ACTTTTGCTCACGTTTCTGCTGTCTGTGTGTGAGTAGTTT
GCTGGTTCATGTCAAAATAAGGTTGTCGACGGAGGTGGTT
TGCCATGGCATCACGAGCAGGACCACGGGCCACAGGAACA
GACGGCAGCGACTACCAGCACCGTGAGCGCGTCGCGTCAC
ACTATCAGATGAGTGTGGCCCTGAAGTCTGAGATCAAGAA
ATTGAACATCGCTCATGCAGTGGTCTGGTTTCTTGTCGCA
GCACAGGTGCTTGTCAGCCAACTTAACCTGGTGTCTCATA
AAGTAGTGGCCTCTCCATACCAGTGGGAATACACATATCT
CCTGAGCATCATACCTACTGTCTTCAGTTTCATGGCTTTA
CCGAAAAACAACATCAGCTATCTGGTCATCTCAATGATCA
GCGGAGGGCTTTTCTGCATCGGCCCTATTCTTTACGGGGG
AATGGAGATGTTCCCTGTGGCTCAGCAGCTTTATCGCCAC
GGCAAAGCTTATAGGTTCATCTTTGGCTTCTCTGCCGTGT
CTATAATGTACTTAGTCTTGATTATTTCAGTTCAGGTACA
CGGCTGGCAGATCTACTACAGTAAAAAGCTGCTGGATGCC
TGGTTCACCAACACACAAGACAAAAAGAAAAAATAAGGGA
CTTCTGGTGGATGTTTAGTGTAAAATAAGTTTTTGTGTCT
TTATTTTGTTTCCTAAAGGCTCTGCAATCAAATAATTGTT
ATGATTAACTGAATTGATCCGAAAAGGAGATCAGATTTGT
TAAACCAGGATGTTCGGTGTCTGTCAAGCTTCTCATCCAC
TGGCTCTCAGCCCAGATCAAGACGTCACTGATGTCCGTTT
CTGCTTGGGTTTGAACTGCTGGCTTTGTAATCTCTATCTG
TTTTCACCATGTTTTCTTCACGCTGTCTTTTCATATACCT
CATGTCTTATGAATCAAACTCAGAAGATCCACAGTTATTC
ATTTAATGAAATAGTTTCATATTTTTTTCTCCCCCCAGTA
ATTTGCTAACAATAAAATGCCAATAAAATGTAATCTTTAA
CAATTTTTGAATATTCTTGTTTAAATTCACAGACAAATTT
ATGATTGCAGTCATGTAACAGATCTAAATGCTAAATGATA
TAACATATATATAACATATATTTCAAAATAATAATAATAA
TAATGAGAAGAAATATTGCTCAATTTACAATATGGTTTGA
ATTTAGTTTGAACTAAGAACAAACAGTACTAGACTAGTAC
AGCATTTATTATTCACAGTTCAACATTTACTAATGCATTA
TGAAATAAATAAAGTAGCATTCTAAAAATTAATGCTTGCT
AACTTTAGTTAATGAACTGTTAACATGAATTTTTATTAAC
AATTAATAAATACTGTAATAGACCATTTTGAAGAATTTAA
ACAATAACAATGGTTCATGTTACTTAACACATTAACTAAC
ATTAAGTGTTACCAAAATATGTTGTGATATACAGTAGGAG
CAATATTGGTCATTGAAATTAATTGGTAAAATACTATATT
TTTTTCTCCTGTATGTGTACAGTATAAATGTTGCCATGTC
TTTTATTTTTACATTCTACAATAAATAAATAATTTTATTT
CTTTGAATCAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jagn1b-201 Contained in:

OTHER jagn1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021948 (1)
  • Ensembl_Trans:ENSDART00000005883 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC078267 (1) 1635 bp
    GenBank:DN859847 (1) 864 bp
    GenBank:CN509483 (1) 823 bp
    GenBank:DT874731 (1) 812 bp
    GenBank:CO934256 (1) 792 bp
    GenBank:CO814101 (1) 780 bp
    GenBank:AL910855 (1) 506 bp
    GenBank:AI558470 (1) 477 bp
    GenBank:AI384293 (1) 389 bp
    CITATIONS (2)