header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5432
Transcript Name: col8a1b-201
Previous Name: col8a1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021947 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021947|OTTDARG00000018153|ZDB-GENE-060503-140 col8a1b|OTTDARP00000018447 CH73-162I18.4-001 LG_ CR956626.9 Danio rerio protein_coding NOVEL, 2945 bp
GGGCCTCTCCTCTCTGCCTGCTTGTTTGTACTGGTGGAGC
ATTTGTGCCTGCTACATCATATCCATGCGGGGGCATTTTA
TGGACACAAACCATTGCCTCAAAAGCGCCAGCCTCTGCCA
CAGTTACCTCTTCTACCACATGGCAATGAAGGAATAACAC
AACACCATTACCATGGAAAGGAAATCCCTCAACTTCCCTT
TGGAAATGAGATGCCTTTGCTTCCACAGTATGGGAAGGAA
CGTCCACAGTTTCCCATGCATATGGGCATACCGATTGCAA
GAAAAGGTGAAACAGTTCCAAGAGGACAGAAAGGTCCTCC
TGGAGAGCCCGGTCCGATAGGGCTTCAAGGGCCTCGGGGC
CCTCCGGGACTTCCTGGTCATGGTATCCCAGGGCCTACAG
GTAAACCTGGTCCTCAGGGCCCACCAGGCCTTCCTGGAAT
TGGAAAGCCAGGTATGGCAGGTTTGCCCGGAAAACCAGGA
GGTATAGGTTTACCAGGGCCAAAGGGTGAGTTAGGACCAA
TTGGTGGTGAAGGACCAATAGGACTACCAGGACCTCCAGG
TCTTCCGGGGCCACATGGCTTGCCAGGTGTGGCGAAACCA
GGGGGACAAGGACTCCCTGGACAACCTGGCCCTCGGGGTG
AACCTGGACAAAAGGGCTTCCCTGGCATCCCTGGCCTCCA
AGGGCCAAAAGGTGAGAATGGTTTTGGTCTCCCAGGATTG
CCAGGCGTAAAGGGACTTCCAGGATTGCCTGGACCACCAG
GACAAGTTGGACTACCAGGAATTGGCAAACCAGGACTGAA
TGGACTACCTGGGGTTCCTGGGGGGCAAGGTAAACCTGGT
GCACCTGGAGAACCAGGGCTAGCTGGAGTACCTGGGGAGA
GAGGACAAATTGGACCACCGGGATTGCCAGGCTTTGGCAA
ACCAGGTTTAGATGGCTTACCAGGGAAACCAGGTCTACCA
GGTGGAAGGGGCGAGCCAGGTCAAACGGGTTTAACTGGGG
GTCCAGGCTTGCCTGGATTTGGCAAGCCTGGTTATCCTGG
CCCTAAAGGTGAAAAAGGGCATGGTGGATTGCCTGGGCCA
ATAGGCCCAAAAGGTGAAAAAGGTCATGGTGGTCTACCTG
GAATGATTGGACTGCAAGGGCCAAGTGGCCTCCCAGGTCC
TCCAGGTCTTATGGGACCCCCTGGAGGCATTGGATTTCCT
GGTCCAAAAGGAGAAGGTGGTGCAGTGGGACCAAAAGGAC
TATTGGGTCCAAAAGGTGAACCAGGACCTCAAGGTCTTCC
TGGCAAGCCAGGATTCCCAGGAGAATTGGGGCAACCAGGA
CCTAGAGGTTTAACTGGTCCCTTAGGACCAAAAGGTGAAA
GTGGACACAAAGGCTTACCCGGGCTGCCTGGAGTGCCTGG
AAAGCCTGGTACAAAAGGAGAACTTGGATTTCCAGGTGAG
AAAGGTCATCCAGGGCCTATGGGAATACCAGGATTAATAG
GTCCAGCAGGACCAATAGGCCCTCCTGGTCTACCTGGTCC
AAAAGGAGAATATGGACCACCAGGAAAACCTGGAATCCCA
GGTGAAGGAAAACCAGGATTTCCAGGCCCAACAGGTCCTG
CTGGTATACCTGGACCGAGTGGGCCCCATGGTCCGCCTGG
AATACCTGGTCCTCCTGGCCCACCTGGGCTACCTGGACCT
CGTGCTCAAGCTTCATTTTTTGGGCAAATACTTCCTGAGA
CAGGTCCTGGGCTTGATGGGGAAAAAGGTGGTTATAAGAA
AGAAAAGCCTGGAGGAGCTATTATTGGTAGGCATGGCCTA
GAAATGCCTGCATTTACAGCTCAGCTGACAACCCCATTTC
CCCAAGTTGGACAACCTGTTGTCTTCAACAAAATTTTGCA
TAATGGAAACCAAAATTACAACTTGCAAACTGGCATCTTC
ACATGCAAAATACCTGGAATTTACTACTTTGTCTACCATG
TTAATTGCAAAGGAAACAATGTATGGGTGGGTTTATACAG
AAACAATGAGCCAGTTATGTATACATATGATGAATACAAG
AAAAGTTACCTGGATCAGGCATCAGGGAGTGCTGTACTGC
CCTTAAACTTTGGAGACACTGTTCACGTTCAGTTACCATC
AGAGCAAGCAGCAGGACTTTATGCTGGTCCTTACGTCCAC
TCATCATTCTCTGGGTATTTGTTATATCCTATGTGAATAT
GTGAAAAAATGCATAAACAATCACATGTTTTTACATGTTT
CTAGTACCACAAAGGCAATGGTTCTTAGTAGAAAATAAGA
CAATGCTAAATATATGATTACACGTACACATAATTTGAAA
ACCATTTCACAGTAACTTTAGGTATTTGTTCAACCATATG
GTAAGCACTTTGTTATCACATTATTTATTTGCATATGACA
GTATAATGATTGTAATTGACATTGACTGCACATCAGTGTA
ATATGATGTGATATTGCCATAATAAGGAATGTTCACATTG
TTGGATATGCACTATTTTTCTGCTGTCTTAGTTTTTCTTT
TAACCATCTCAATAAATTTCAGGAAAGTATGTGAGCACAT
GCAAACAGGTTATCTCATTAACTAACAGCATAAGTAAAAT
ACATATCTAAAAACTTCCTGAAACTTTCATTTACAAAAGC
TTATTTAAAACCCAATTTATCAAAATATAACTCAGTTGTA
TTGTTTGTCAGTGAGTTCATTTTCAGTTTTAAATGTGTAT
ATGGCCACATAAACACTCAAACAGTCCTAGGTAAATGTCT
GTAATTTATTTTAATTTTTACTACTGAATGAATAAATTTG
TATATGCGCACAGAGACAGTGGAGCACACAACAGAGGGAG
TTTATTCTTTGTTCATTTCTATGTTATTGTGGTGCTAAAC
TGTCAAACAAATATTAATTAAAATTTTATGTCAGTTTTTT
TTTTTAATAAAATGTATTTACTGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
col8a1b-201 Contained in:

OTHER col8a1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021947 (1)
  • Ensembl_Trans:ENSDART00000019846 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN898414 (1) 568bp
    GenBank:DN859966 (1) 476bp
    CITATIONS (2)