Transcript

col8a1b-201

ID
ZDB-TSCRIPT-090929-5432
Name
col8a1b-201
Previous Names
  • col8a1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021947 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021947|OTTDARG00000018153|ZDB-GENE-060503-140 col8a1b|OTTDARP00000018447 CH73-162I18.4-001 LG_ CR956626.9 Danio rerio protein_coding NOVEL, 2945 bp
GGGCCTCTCCTCTCTGCCTGCTTGTTTGTACTGGTGGAGC
ATTTGTGCCTGCTACATCATATCCATGCGGGGGCATTTTA
TGGACACAAACCATTGCCTCAAAAGCGCCAGCCTCTGCCA
CAGTTACCTCTTCTACCACATGGCAATGAAGGAATAACAC
AACACCATTACCATGGAAAGGAAATCCCTCAACTTCCCTT
TGGAAATGAGATGCCTTTGCTTCCACAGTATGGGAAGGAA
CGTCCACAGTTTCCCATGCATATGGGCATACCGATTGCAA
GAAAAGGTGAAACAGTTCCAAGAGGACAGAAAGGTCCTCC
TGGAGAGCCCGGTCCGATAGGGCTTCAAGGGCCTCGGGGC
CCTCCGGGACTTCCTGGTCATGGTATCCCAGGGCCTACAG
GTAAACCTGGTCCTCAGGGCCCACCAGGCCTTCCTGGAAT
TGGAAAGCCAGGTATGGCAGGTTTGCCCGGAAAACCAGGA
GGTATAGGTTTACCAGGGCCAAAGGGTGAGTTAGGACCAA
TTGGTGGTGAAGGACCAATAGGACTACCAGGACCTCCAGG
TCTTCCGGGGCCACATGGCTTGCCAGGTGTGGCGAAACCA
GGGGGACAAGGACTCCCTGGACAACCTGGCCCTCGGGGTG
AACCTGGACAAAAGGGCTTCCCTGGCATCCCTGGCCTCCA
AGGGCCAAAAGGTGAGAATGGTTTTGGTCTCCCAGGATTG
CCAGGCGTAAAGGGACTTCCAGGATTGCCTGGACCACCAG
GACAAGTTGGACTACCAGGAATTGGCAAACCAGGACTGAA
TGGACTACCTGGGGTTCCTGGGGGGCAAGGTAAACCTGGT
GCACCTGGAGAACCAGGGCTAGCTGGAGTACCTGGGGAGA
GAGGACAAATTGGACCACCGGGATTGCCAGGCTTTGGCAA
ACCAGGTTTAGATGGCTTACCAGGGAAACCAGGTCTACCA
GGTGGAAGGGGCGAGCCAGGTCAAACGGGTTTAACTGGGG
GTCCAGGCTTGCCTGGATTTGGCAAGCCTGGTTATCCTGG
CCCTAAAGGTGAAAAAGGGCATGGTGGATTGCCTGGGCCA
ATAGGCCCAAAAGGTGAAAAAGGTCATGGTGGTCTACCTG
GAATGATTGGACTGCAAGGGCCAAGTGGCCTCCCAGGTCC
TCCAGGTCTTATGGGACCCCCTGGAGGCATTGGATTTCCT
GGTCCAAAAGGAGAAGGTGGTGCAGTGGGACCAAAAGGAC
TATTGGGTCCAAAAGGTGAACCAGGACCTCAAGGTCTTCC
TGGCAAGCCAGGATTCCCAGGAGAATTGGGGCAACCAGGA
CCTAGAGGTTTAACTGGTCCCTTAGGACCAAAAGGTGAAA
GTGGACACAAAGGCTTACCCGGGCTGCCTGGAGTGCCTGG
AAAGCCTGGTACAAAAGGAGAACTTGGATTTCCAGGTGAG
AAAGGTCATCCAGGGCCTATGGGAATACCAGGATTAATAG
GTCCAGCAGGACCAATAGGCCCTCCTGGTCTACCTGGTCC
AAAAGGAGAATATGGACCACCAGGAAAACCTGGAATCCCA
GGTGAAGGAAAACCAGGATTTCCAGGCCCAACAGGTCCTG
CTGGTATACCTGGACCGAGTGGGCCCCATGGTCCGCCTGG
AATACCTGGTCCTCCTGGCCCACCTGGGCTACCTGGACCT
CGTGCTCAAGCTTCATTTTTTGGGCAAATACTTCCTGAGA
CAGGTCCTGGGCTTGATGGGGAAAAAGGTGGTTATAAGAA
AGAAAAGCCTGGAGGAGCTATTATTGGTAGGCATGGCCTA
GAAATGCCTGCATTTACAGCTCAGCTGACAACCCCATTTC
CCCAAGTTGGACAACCTGTTGTCTTCAACAAAATTTTGCA
TAATGGAAACCAAAATTACAACTTGCAAACTGGCATCTTC
ACATGCAAAATACCTGGAATTTACTACTTTGTCTACCATG
TTAATTGCAAAGGAAACAATGTATGGGTGGGTTTATACAG
AAACAATGAGCCAGTTATGTATACATATGATGAATACAAG
AAAAGTTACCTGGATCAGGCATCAGGGAGTGCTGTACTGC
CCTTAAACTTTGGAGACACTGTTCACGTTCAGTTACCATC
AGAGCAAGCAGCAGGACTTTATGCTGGTCCTTACGTCCAC
TCATCATTCTCTGGGTATTTGTTATATCCTATGTGAATAT
GTGAAAAAATGCATAAACAATCACATGTTTTTACATGTTT
CTAGTACCACAAAGGCAATGGTTCTTAGTAGAAAATAAGA
CAATGCTAAATATATGATTACACGTACACATAATTTGAAA
ACCATTTCACAGTAACTTTAGGTATTTGTTCAACCATATG
GTAAGCACTTTGTTATCACATTATTTATTTGCATATGACA
GTATAATGATTGTAATTGACATTGACTGCACATCAGTGTA
ATATGATGTGATATTGCCATAATAAGGAATGTTCACATTG
TTGGATATGCACTATTTTTCTGCTGTCTTAGTTTTTCTTT
TAACCATCTCAATAAATTTCAGGAAAGTATGTGAGCACAT
GCAAACAGGTTATCTCATTAACTAACAGCATAAGTAAAAT
ACATATCTAAAAACTTCCTGAAACTTTCATTTACAAAAGC
TTATTTAAAACCCAATTTATCAAAATATAACTCAGTTGTA
TTGTTTGTCAGTGAGTTCATTTTCAGTTTTAAATGTGTAT
ATGGCCACATAAACACTCAAACAGTCCTAGGTAAATGTCT
GTAATTTATTTTAATTTTTACTACTGAATGAATAAATTTG
TATATGCGCACAGAGACAGTGGAGCACACAACAGAGGGAG
TTTATTCTTTGTTCATTTCTATGTTATTGTGGTGCTAAAC
TGTCAAACAAATATTAATTAAAATTTTATGTCAGTTTTTT
TTTTTAATAAAATGTATTTACTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations