Transcript

si:ch211-225k7.4-201

ID
ZDB-TSCRIPT-090929-5429
Name
si:ch211-225k7.4-201
Previous Names
  • si:ch211-225k7.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021932 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021932|OTTDARG00000018138|ZDB-GENE-060503-28 si:ch211-225k7.4|OTTDARP00000018434 CH211-225K7.4-001 LG_ CR318630.14 Danio rerio protein_coding NOVEL, 1163 bp
AGACAGAAACATCAGACTGAGGACAGAAACACACCAGCTC
TGAGAAATGGCTCAAACTCTATATTCCCCTCTTCTCCTCA
TTGCTCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTA
TCACTTTATAAATGAGAACAAGAACTGGACTGAAGCTCAG
AGATACTGCAGAGAGAAATACACAGATCTGGCCACTGTTG
ACAACATGAATGACATGATCCAGCTGAAGAAGATTGTGAA
TGCTGTAAATGATGAGTATATCTGGATTGGTCTTCAGAAG
ACGAGTGTTTATAAATGGCATTGGTCTTCAGGTGATCCTG
TGCTCTTTATGAACTGGTATTTTGGAGAACCAGCTGACAG
TGATAATTGTACTATGATGAGAAATGGACAGTGGTTTGTT
GTGCCATGTAGTAACACCTCATTCTTCATCTGCTTCAACA
CCAGCAGAGGACTGGTGTTTGTCAAACAGACAATGAACTG
GAGAGATGCTCAGAGTTACTGCAGACAGAATCACATTGAT
CTGGTCAGTGTGAGGAACCAGAATGAGAATCAACAGCTGG
AGAAGTTCATTAATGACAGAAAATCATCTGGATCTACAGT
CTGGATCGGTCTGTTCAGAGACTCATGGCAGTGGTCAGAT
CAGAGCAGCTCCTCATTCAGATACTGGGATAACAATCAAC
CTGATAATAGAGGAGGAATTGAAAACTGTACAGTGATCAC
TCAGAATGTTCAGAGACAATGGCATGACATCTCTTGTGAA
CATCATTTCTGCTTTGTTTTGTGTCCAGATAAACTGCTTG
TGGTCCAGCAGAATCTGTTGTGGTCTGAAGCTCTGAGATA
CTGCAGACAGCATCATGTGGATCTGGTCTCGGTTCAGTCA
GAGGAGATGCAGTATAAGGTGATGAACGTGGTTAAACTGG
CATCTACTGAGGCGGTGTGGTTGGGTTTACGTCACTCCTG
TGCTTTGGGCATCTGGTTCTGGGTGAGAAGACAGACCGTG
TGCTATCAGAACTGGGCTCCAGGGAACGGCACATCAGAGG
AGGACTGTGAGCCCACAGTGAGATCTGGAGCAGTTCAGTC
TGGAGAAAATCAGACCTGGATCAGCTGCCCAGAAACTGAC
ACACTCAACTTCATCTGCAGAAATTATTAAGTCAAAGACT
GGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations