ZFIN ID: ZDB-TSCRIPT-090929-5429
Transcript Name: si:ch211-225k7.4-201
Previous Name: si:ch211-225k7.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021932 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021932|OTTDARG00000018138|ZDB-GENE-060503-28 si:ch211-225k7.4|OTTDARP00000018434 CH211-225K7.4-001 LG_ CR318630.14 Danio rerio protein_coding NOVEL, 1163 bp
AGACAGAAACATCAGACTGAGGACAGAAACACACCAGCTC
TGAGAAATGGCTCAAACTCTATATTCCCCTCTTCTCCTCA
TTGCTCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTA
TCACTTTATAAATGAGAACAAGAACTGGACTGAAGCTCAG
AGATACTGCAGAGAGAAATACACAGATCTGGCCACTGTTG
ACAACATGAATGACATGATCCAGCTGAAGAAGATTGTGAA
TGCTGTAAATGATGAGTATATCTGGATTGGTCTTCAGAAG
ACGAGTGTTTATAAATGGCATTGGTCTTCAGGTGATCCTG
TGCTCTTTATGAACTGGTATTTTGGAGAACCAGCTGACAG
TGATAATTGTACTATGATGAGAAATGGACAGTGGTTTGTT
GTGCCATGTAGTAACACCTCATTCTTCATCTGCTTCAACA
CCAGCAGAGGACTGGTGTTTGTCAAACAGACAATGAACTG
GAGAGATGCTCAGAGTTACTGCAGACAGAATCACATTGAT
CTGGTCAGTGTGAGGAACCAGAATGAGAATCAACAGCTGG
AGAAGTTCATTAATGACAGAAAATCATCTGGATCTACAGT
CTGGATCGGTCTGTTCAGAGACTCATGGCAGTGGTCAGAT
CAGAGCAGCTCCTCATTCAGATACTGGGATAACAATCAAC
CTGATAATAGAGGAGGAATTGAAAACTGTACAGTGATCAC
TCAGAATGTTCAGAGACAATGGCATGACATCTCTTGTGAA
CATCATTTCTGCTTTGTTTTGTGTCCAGATAAACTGCTTG
TGGTCCAGCAGAATCTGTTGTGGTCTGAAGCTCTGAGATA
CTGCAGACAGCATCATGTGGATCTGGTCTCGGTTCAGTCA
GAGGAGATGCAGTATAAGGTGATGAACGTGGTTAAACTGG
CATCTACTGAGGCGGTGTGGTTGGGTTTACGTCACTCCTG
TGCTTTGGGCATCTGGTTCTGGGTGAGAAGACAGACCGTG
TGCTATCAGAACTGGGCTCCAGGGAACGGCACATCAGAGG
AGGACTGTGAGCCCACAGTGAGATCTGGAGCAGTTCAGTC
TGGAGAAAATCAGACCTGGATCAGCTGCCCAGAAACTGAC
ACACTCAACTTCATCTGCAGAAATTATTAAGTCAAAGACT
GGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-225k7.4-201 Contained in:
[BAC] CH211-225K7 (1)

Genome Resources: Vega_Trans:OTTDART00000021932 (1),  Ensembl_Trans:ENSDART00000139880 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC171481 (1) 1271 nt
GenBank:CF997417 (1) 765 nt
GenBank:DT068150 (1) 755 nt
GenBank:BQ259957 (1) 613 nt
CITATIONS (2)