Transcript

si:ch211-225k7.5-201

ID
ZDB-TSCRIPT-090929-5428
Name
si:ch211-225k7.5-201
Previous Names
  • si:ch211-225k7.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021931 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021931|OTTDARG00000018137|ZDB-GENE-060503-123 si:ch211-225k7.5|OTTDARP00000018433 CH211-225K7.5-001 LG_ CR318630.14 Danio rerio protein_coding NOVEL, 1140 bp
GAAACATCAGACTGAGGACAGAAACACACCAGCTCTGAGA
AATGACTCAAACTCAATACTTCCTCCTGCTGATTGCTCTC
TGCTCCATATCTGAATGTGTTCAGCGTCAGTATCACTTTA
TAAATGAGAAGAAGACCTGGACTGAAGCTCAGAGATACTG
CAGAGAGAAATACACAGATCTGGCCACTGTTGACAACATG
AATGACACGATCCGGCTGAGGAAAAGTGTGAATGATGAAC
GCATCTGGATTGGTCTTCAGAAGACGAGTGTTTATAAATG
GCATTGGTCTTCAGGTGATCCTGCGCTCTATCTGAACTTG
TCATCTAGTCCAGCCAACAATAATAATTGTACTTCTAAGA
TGAGAAATGGACAGTGGTCTGTTGTGCCATGTAATAACAA
CAATTACTTCATCTGCTACAACATGAGCAGAGGATTCGTG
TTTGTCAATCAGACGATGAACTGGACAGCTGCTCAGAGTT
ACTGCAGACAGAATCACACTGACCTGGTCACTGTGAGGAA
CCAGAATGAGAATCAACAGCTGGAGAAGTTCATTAATGAC
AGAAACTTTTCTAGATCTTCAGTCTGGATCGGTCTGTTCA
GAGACACATGGCAGTGGTCAGATCAGAGCAACTCCTCATT
CAGATACTGGGATACTGGTAAACCAAATAATTCTGGAGGT
AATGAAAGCTGCACAGTGATTGGTCAGAATTCTCAGAGAG
GATGGGAAGAAGTCTCTTGTGACCGCCAGTATCCTTTTGT
GTGTCATGAAGATAAACTGATTGTGATCCAGCAGAATCTG
TCGTGGTCTGAAGCTCTGAGATACTGCAGACAGAATCATG
TGGATCTGGTCTCGGTTCAGTCAGTGGAGATGCAGCGTCG
TGTGATGAACGTGGTTAAACTGGCAACTACTGAGGCGGTG
TGGTTGGGTTTGCGTTTCTCCCACATTTCGGGCATCTGGT
TCTGGGTGAGTGGAGAGACCGTGTGCTATCAGAACTGGGC
TCCAGGGAACGGCACATCAGAGGAGGACTGTGAACCCACA
GTGAGATCTGGAGCAGTTCAGTCTGAAGGAGATCAGACCT
GGATCAGCCGTCCTGAAACTGACAGACTCAACTTCATCTG
CAGCAGATATGAGTAAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations