ZFIN ID: ZDB-TSCRIPT-090929-5428
Transcript Name: si:ch211-225k7.5-201
Previous Name: si:ch211-225k7.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021931 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021931|OTTDARG00000018137|ZDB-GENE-060503-123 si:ch211-225k7.5|OTTDARP00000018433 CH211-225K7.5-001 LG_ CR318630.14 Danio rerio protein_coding NOVEL, 1140 bp
GAAACATCAGACTGAGGACAGAAACACACCAGCTCTGAGA
AATGACTCAAACTCAATACTTCCTCCTGCTGATTGCTCTC
TGCTCCATATCTGAATGTGTTCAGCGTCAGTATCACTTTA
TAAATGAGAAGAAGACCTGGACTGAAGCTCAGAGATACTG
CAGAGAGAAATACACAGATCTGGCCACTGTTGACAACATG
AATGACACGATCCGGCTGAGGAAAAGTGTGAATGATGAAC
GCATCTGGATTGGTCTTCAGAAGACGAGTGTTTATAAATG
GCATTGGTCTTCAGGTGATCCTGCGCTCTATCTGAACTTG
TCATCTAGTCCAGCCAACAATAATAATTGTACTTCTAAGA
TGAGAAATGGACAGTGGTCTGTTGTGCCATGTAATAACAA
CAATTACTTCATCTGCTACAACATGAGCAGAGGATTCGTG
TTTGTCAATCAGACGATGAACTGGACAGCTGCTCAGAGTT
ACTGCAGACAGAATCACACTGACCTGGTCACTGTGAGGAA
CCAGAATGAGAATCAACAGCTGGAGAAGTTCATTAATGAC
AGAAACTTTTCTAGATCTTCAGTCTGGATCGGTCTGTTCA
GAGACACATGGCAGTGGTCAGATCAGAGCAACTCCTCATT
CAGATACTGGGATACTGGTAAACCAAATAATTCTGGAGGT
AATGAAAGCTGCACAGTGATTGGTCAGAATTCTCAGAGAG
GATGGGAAGAAGTCTCTTGTGACCGCCAGTATCCTTTTGT
GTGTCATGAAGATAAACTGATTGTGATCCAGCAGAATCTG
TCGTGGTCTGAAGCTCTGAGATACTGCAGACAGAATCATG
TGGATCTGGTCTCGGTTCAGTCAGTGGAGATGCAGCGTCG
TGTGATGAACGTGGTTAAACTGGCAACTACTGAGGCGGTG
TGGTTGGGTTTGCGTTTCTCCCACATTTCGGGCATCTGGT
TCTGGGTGAGTGGAGAGACCGTGTGCTATCAGAACTGGGC
TCCAGGGAACGGCACATCAGAGGAGGACTGTGAACCCACA
GTGAGATCTGGAGCAGTTCAGTCTGAAGGAGATCAGACCT
GGATCAGCCGTCCTGAAACTGACAGACTCAACTTCATCTG
CAGCAGATATGAGTAAATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-225k7.5-201 Contained in:
[BAC] CH211-225K7 (1)

Genome Resources: Vega_Trans:OTTDART00000021931 (1),  Ensembl_Trans:ENSDART00000135106 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT068150 (1) 755 nt
GenBank:BQ259957 (1) 613 nt
CITATIONS (2)