Transcript

dad1-201

ID
ZDB-TSCRIPT-090929-5392
Name
dad1-201
Previous Names
  • dad1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021840 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021840|OTTDARG00000018073|ZDB-GENE-060503-233 dad1|OTTDARP00000018362 dad1-001 LG_ AL929335.9 Danio rerio protein_coding KNOWN, 890 bp
GATACACGTCATTCATTTCCTTGCTGCTTGGATTTTCAGG
TGTCTGTGCGCATTTCCAGCAGACATCATGTCTAATTCGG
TGTTTTCCGTCATATCGCGTTTTGTAGAGGAATACAGAAG
CAGCACGCTGACTAAGCTGAAGGTCATCGACGCGTATCTG
CTGTATATTTTGCTGACCGGAGTCTTCCAGTTCTTGTACT
GTCTGCTGGTGGGAACCTTCCCCTTCAACAGCTTCTTATC
TGGCTTCATTTCATGTGTGGGGTCCTTCATACTGGCTGTG
TGTCTTCGCATCCAGATCAACCCTCAGAATAAAGGAGATT
TCCTCACGGTCTCTCCTGAAAGAGCGTTCGCTGATTTCCT
TTTTGCTCACACTGTTCTCCATCTAGTGGTGGTCAATTTT
GTGGGCTGAATGAGACTCTCTGCTCTGCGGTCCCTACAGC
TGAAATGAAGACCAAACGCTTCAGCTCAAGAACAGATCAA
CTACAAACACAACAGCCTGCGCTTCTCTCAATGTTAATGT
ATATGCTTTGACAGAATTGTCAGCTATGAGTTCCTGTCTT
CATCCTTAATTTTTCTACTTTTGTAAAACTTACTGAGAGT
TATGGAAACAAAATAAATGCCTTGAAAACACATTTTGGTG
AATCGAATTGTGTTTTACTAAATTTTACCAGGGTGTCCTC
GGAGTTTCAAAAAATATAAATTTTTAAATCAATTTAAAAA
AATTAAGGCTCTCAAAAAGTATTATAAAAGTCTTAAATGC
TATTTTGCAAGCTAATAAATTGTGTATCATTTTTGATAAT
GCAATGTATTCTAAAGTTTGGCTAAATTTAATCCGTGAAA
ATTGGGTGCTGTGTACTTTATGAAATCAATAACAATCCTG
CTAGATTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations