header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5306
Transcript Name: ttc33-201
Previous Name: ttc33-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021716 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021716|OTTDARG00000017974|ZDB-GENE-040718-480 ttc33|OTTDARP00000018268 DKEY-204L11.4-001 LG_ CR762390.5 Danio rerio protein_coding KNOWN, 1735 bp
GGACAAGTCCAAAACATTTGTGAGAAAACGCGAAGCTGTT
GCAGAACCACGGTCTGTCATGGTGCAGTGGTGAATTATTT
TGCATTTATGAACCAGAATGGCCTCCTTTGGCTGGAAGCG
TAAGGTGGGGGAGAGAGTTTCCAAGCAGACGGTACAGCAG
TTTGAGCAGGACTCGGAGCAGGCGGATGAGGATGAAGTTG
AGCGAGAGGGAGTTGACTGGCTGCATGTGATCAAACGGAA
ACGAGAGGTGCTGCTGGAGGACTGCGCTGCTAAAAGCAAG
AGACTAAAGGAAGAAGGAGCCCTGCTTGCTGAACAGGACA
GGAACTGGGAGGCATTGAAGAAGTGGGACGAGGCAGTTCA
GCTCACACCAGAGGATGCCGTGTTGTATGAGATGAAGTCC
CAGGTGTTGATCACCCTTGGAGAGGTGTTTCTGGCAGTGC
AGTCTGCAGAGATGGCCACCAGACTCCGCCCCATTTGGTG
GGAGGCGTGGCAAACCCTGGGCCGTGCTCAGCTAAGTCTT
GGAGAAGTGGAACTAGCTGTACGGTCTTTCCAAGTGGCGC
TGCACCTGCATCCGTCTGAGCGTCCTCTCTGGGAGGAAGA
CCTCAACTGGGCTTTAAAGCTCCGAGAGAACCAGCAATCT
CTCCGTGAAAAAGCGTCCCAGGTAGATGAAGCCCGAAGGC
TCCTTGTGGAAGCTCCCGAGTTAAAAGGCGATTATGATTT
TGAAAGCGATGAAGTGATTGAGGCTTGCTCCGCCATGGCT
GATAGGCAGAAGCAATATGAGGACTTGAAGAAAAAGGCTG
TAGTTGTGGATGCACACGGGGAGGCCAAAGAGATGCTTGT
TGAAGGGGATGACAATCCAACTTCCTCCTCACAGAGTGTT
TTAATCAAAGCACGAGGACTCTAAGGGAAATGGAAGCTGT
TTTTGTGTCGTCTCCTCATTGTATATTATCCCATATGATT
TATTTAAATGGAAAGTTCACCCAAAAATGAAAACATACTC
ACCCTCTCAAGTGGATCCTACTGTAACATTTATGAGTTTC
CTTTTGAAGATATGAGATATTTTAAAGAATGCCTTTTCAT
AGGTGGAAAAACAAATACTATAGAGGTCAGTTGCTACATA
CAGTACTCAACATTCGAAGTGAATCAAAAACGTTTTTCAA
AATTGTCCTAGCACAGAAATGTGTGCTGTTTAATAGTTTT
AGGACAACTTTGGTGAAATGTGGTGATCCACTTCAAATGT
TGATTGCTGTTTATCAAAATAAAATTTAAATGACTGTGCT
GTTTAATAAAGTTCTCATTCCTAGAAAATTTGTACAGTAC
ACTGAAAAAATATGTCTGCAAAATAGTTGCAAACAGTTTA
TATGGGTTATAATTAGTATAATGTTTAACTTAATTAGTAT
GTTTAAATCCAAGGAATCATCTATGAATATTTTTGAATAA
TTTTTTTCAGTTTAAGCACCAGATTTTCAAGATAATCAAG
TTCGTTGAAATCACTTTCATTTCTCCAGCAGGAATATAAA
CTCATTTCTTTTACTGAAGCATTTTGTGGTTATTGGATTT
AGTTTTGATGGTGCTATCCATTGGTTTTTTTAAGATATCA
AAATGGCAAAGCAATCTCTACTTAATGTGCCACCTTGATT
AGAAATGCCATCTATCCCAATCAGCTTTGTCTCCATGTGA
GATGTGTGTTCTCTAGGAATGTACTAAAATAAAAAATCTG
GGTTGAGGCTGAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ttc33-201 Contained in:
OTHER ttc33-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021716 (1)
  • Ensembl_Trans:ENSDART00000051312 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC075750 (1) 1745bp
    GenBank:CN021588 (1) 945bp
    GenBank:CN507370 (1) 886bp
    GenBank:DN769196 (1) 789bp
    GenBank:CV112357 (1) 786bp
    GenBank:BQ259491 (1) 623bp
    CITATIONS (2)