Transcript

ophn1-202

ID
ZDB-TSCRIPT-090929-5304
Name
ophn1-202
Previous Names
  • ophn1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021714 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021714|OTTDARG00000017973|ZDB-GENE-040718-464 ophn1|OTTDARP00000018267 ophn1-001 LG_ CR396593.6 Danio rerio protein_coding KNOWN, 3072 bp
AGTATGTAGCCCTGCCCGCGTTCGTCAGTCCCTCCGCTCC
CAAAACAAGGAAAAGTATAGAAACAAATAGTTTCTTTATC
AGCGCTTTTAAGTTTTACTTTGCCACTCCATTTGCGCGAC
CGAATTAGTTTTAATAGGAAAAGCGCGCGCACCCGGACAC
CGTCACCACCGCAGCGCTGGATTATTGTTTTTTCCACAAC
TGCACATCACATAGTATGTCAAATATGGGGAACTTTATTG
TAATCTGTTAACTGAAATTTTAATTAATACAGGCGAGCGA
TCATAGTGCAGGTGTGTCGTGGTTTTGTGTACTTTGCCGA
CAGCAGAAGAGTTATTCTTCACTGAGACTGAGAATGGTTC
ATCCTGCACTGGAGTTCAGCGACTGTTACTCCGACAGCCC
CGATTTCAGAGAGAGATTGAAATGCTACGAAAACGAGCTG
GAGAAAACCAACAAGTTCCTAAAGGATGTCATCAAGGACG
GGAACAATGTGATCAACACGTTTAAAGAGTACTCGCTAGC
TGTGCAGAAGTTCTCTCAGACTCTTCAGTCTTTCCAGTTT
GATTTCATCGGTGACACTCTGACTGATGATGAGATGAACA
TCGCTGAGTCATTTCGTGAGTTTGCTGGTTTGCTGCAGGA
CGTGGAAGAGGCCCGAATGATGCTGGTTCAGAATGCTTCT
GACCTGCTTATCAAACCTTTGGAAAAGTTCAGGAAAGAGC
AGATTGGAGTGACAAAAGAGAGACGAAAGAAGTTTGAGAA
GGAAAGTGAAAAGTATTACTCTCAGCTGGACAAGCACGTG
AACTTGTCCTCAAAGAAAAAAGAGACACAGCTACAGGAGG
CTGATGAACAGTTGGATAAGGAGCGTCAGGCTTTTTATGA
ATCGTCTGTTGAATATGTATACCAGATCCAGCAGGTTCAG
GAAAAGAAGAAGTTTGATGTTGTGGAGCCTGTTTTAGCAT
TTCTACAGAGCATCCTGACGCTGAATAATCTCACCGTTGA
GATGACACAGGATTTCCTACCATACAAACAGGAGCTTCAG
CTCAGTCTACAGAATACCCGTAACCACTTTGAGAGCACCA
GAGAGGAGATGGAAGAGCTAATGAAAAGAATGAAAGGGTC
AGCAAAGATCAGTATTAGACATGGCCAGCCTGCGACTATG
GAGGGTTACCTCTATGTGCAGGAGAAATGGGCTCTTGGCG
TAACCTGGGTGAAGAATTACTGTAAATATTTCAAGGACAA
CAAGTTATTTATTATGGTGCCAATGGAACAGAAGGCGGGA
ATCAAACAGACCACAGCTCAACTCACACTGAAGTCCTGCA
TACGACGTAAAACTGACTCCACCGATAAACGCTTCTGCTT
TGACATTGAGACCAGTGAAAGAGGCAGCCCTGTCCTGCTC
CAGGCTATTTCTGAGGTCAACAGGAAGCAGTGGATAGAGG
CCATGGATGGGAAAGAACCAATTTATCATTCTCCCATTCA
AAAGCAGGCAGAGATGGAGCTGAATGACCTCGGCTTCAAG
TTTGTCAGAAAATGCATCAACTTTGTGGAAACAAAAGGGC
TGACTCAGGAAGGGGTCTACAGGACAGTGGGCAGCAATAT
TCAAGTACAGAAACTTCTGAATGCCTTCTTTGACTCAAAG
TGTCCTGCTGATGTAGATTTTAATTCCAGTGACATGGACA
TTAAGACCATCACCAGTGCACTGAAATTCTATCTGCGGAG
TCTGAGTGAACCGCTGATGACCTACAGCCTGCACGGAGAA
CTGATCTTAGCAGCAAAGTCAGAGAATCTGGACTATCGGT
TAGGGGCGGTTCACTCACTTGTTTACAAACTCCCCGAGCG
GAACAGAGAGATGCTGGAACTGCTAATCAAACACCTGGTC
AGTGTTTGCAGCCACAGCAGTGAAAATCTTATGACTGTGT
CCAATATGGGTGTAATATTTGGCCCCACTCTTATGAGAGC
AGAGGAGGAGACGGTAGCGGCCATGTTGGATATTAAGTTC
CAGAACATCGTCATGGAGATTCTTATTGAGGACTACAGCA
AGATCTTTAAAGGTCCTCCTGAGGAAAGCGTACCACCTCC
TGTCCCGCCTCCAAGGGTGTCACCACGAAGACGACAGCCA
ATCACCATCTCAAAACGCCCAGCTCGTGTCTACACTGGTC
TTCAGCCTCCCGCATTTGAGCGTCGAGAGCTGAATGGTGC
CACACACAATAATGGTGAACCTGAGGGAGACGGCGGCCCC
GTTCCTCAACAAAGAACAAAACTGATACCTCCTTCCATCT
CTCCTCCATCCATCCCACTCTCCTCTCCCACGTCCAGGAG
ACCTCTTCATCCCAGACCTGCTGTTCGGCTATTGGAGCCT
GAAGTCAGCCGTTTTGATGCTCGGATACAGGACGGCCTGA
GGTCAGACGCCACCACCAATGGGGATTCCGGGGGCACGGT
GAACCGCGCTCAGTCTTTCCAGAAGAGGACACAACTCAAG
GGAACAACTGGTAAACAAGCAGCAGCAGCAGCTGGCAACT
CACGAGAGGCACAGGGTCTGAAAAGACGATCTTTCTCAGA
GAAGAGTTCCATCTGCAGGCCCCCGACTCGACCACCAGAC
CCCCCTTCACGGCTCTTCAGTAAACCTCCAAATGAAGACA
CTCCACCATCATATGTTGCATCCAAAACCAAATTTTTTGA
GAACGCTTCCAGGCAGATGGGGAGCTCCTCTCCGAACGCC
TCACCTGCAGCGTCAAGAGACGAGAACACTAAATGAGAAC
TTGAGGATGGATGTGGATGTGGAAGCGCTTTACACATGAC
TGCGTGTCCTCGTACGGCACAGGCCAGAGTCCGGATGCGG
ATTTGAGAGATAAATTATTAATATGACTGACAGAGCACAA
GGCACGGCCCTTCACTACAGTTTTTTTTTTTTTTTTTTTT
TACGAAAGTACTTTTCTTTTTTTTTTCGCCGCCAATTTCT
GCACTTGCTTACTAAGTGGTTGTTTCTCGCTTGGATCGAA
GAACAAAAGGAAAGCATTGAATCTTTTTTTTTTTTTTTTC
TTGCTTAAACATTTTGACCTTCCTGCGCACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations