ZFIN ID: ZDB-TSCRIPT-090929-53
Transcript Name: homeza-201
Previous Names: homez-001, homeza-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002045 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002045|OTTDARG00000001914|ZDB-GENE-030616-592 homeza|OTTDARP00000001802 CH211-14A17.9-001 LG_ AL928674.5 Danio rerio protein_coding NOVEL, 2117 bp
GATCCTCTCCGTCTAGCCTCGGTCTGACCGGACAGGCGAA
AAACACTTTGGGATTTCCAGAACAAAAGCGACAACGGAGA
ATACAGACCAGCTGAAGTGGCGTCTCCACAAACAACCCTG
AGAGAAATTCAAGCGTCTGTGGCAATAGAGGTGTGACATC
TCTGATGGCGACGCACAGTGTCCATGACCTGAAAATTATC
TCTCCAAGAGGGGTGGCAGTAAAAAGGCAAGATGGAACCT
TCACCAGCTCAAAGCAGCAAAAATCACCATACCAACACAA
TTCCGATAGAAAAGAACATGCAAGTGCCTCCAATCACAGA
CCAAGAGAGAGCAATGGCACCACCGCAGCAAGCTTTAGCA
CTAACAATAACTCTGTAGTATGTCTTCCTTTGGTGTCTGA
AGGACTGAAGCTAGTGTGGACACAGTCTGATCAAACACGT
GAGCTGGATAGCATTCCTGAACTTGTTCAGGCCTTTAACA
TCTTTCCCTACCCAACATCTCAAGAGGTCAGCACTCTTGC
ACGTGTGTGCACTCTTCCATTAGATAAAGTCAAAGTGTGG
TTCATGGTGCAACGCATCAAGTATGGAATCAGCTGGGCTT
CAGAGGACATTGAAGAGACACGGCTCAAGCTGGCCAGGCC
AGAGCAAAAAACTGAGACTGAACATAAAGAGAGCAGTACT
AAGAGGAAAAATGATAGTAAGGATTTTACAGAGGTAGAAG
ATCTAGCACAAAGTCCACAAATGCCTCGCAAAAGACCTAA
AACTGAAAGTACAGAACCAGCAAAGCTCTCTCCTGCTCCC
TCACGTTTCCGTTCATCCCTCCCTCCACCTCAGGATTCAT
ACTACTACCGACAACCAGTAGAAATACCAGAGACGTCTCA
AGCAGCTACCCCCCCTACAGCTACAGAGTCTCCAGTTGTA
TCTGAGCAGCCACGGCATAGCCGCTACAAAAAGTCCAAAG
CCCAGTTAACTGCTCTGCGTAAGAGTTTTCTACAGGAGAA
CTGGCCTGATGAGACTGAGCTTCAGCGCTTACAAGATGAG
ACAAGCCTAACTCGTAATGAGATTCGAAAATGGTTTAGTG
ACAGTCGCTACCAGCTACGGATGGGTAGGGGGTTGCAAAT
GTCCCTCCCTGCTACTCAAGGAGAAAAAGATGATCCCAAC
TGCAGCCTGTCACCACAGTCTCAGGAGGCTCAGCCACTTT
CTCTCACTACTAAAAAGCAAACTACGCAGCATGTTGACAA
CAAAGGCAAGGAAAAGACTTGTGTTAAAGGATCGCGAAGG
AATCGGCCAAAGACCTCCCAGTTTTTCCAGCTTTTCCTGT
CTAACACACTTGAGTCATTTGAAGAAGGAACAATAAGAGT
GGATGAGGAGAAATGTTCAGAAGAAAGTGAGACGCAGAAC
AATGATGAAGTTGCAAGTGAACAGGAAAGTGAAGGACGTT
GTGTGGCAACACCAGAGCCAGCAGCACCCACTTCCTCCTC
CTCTCCTCCGTCCATCACCCCATCCAAGAAACACACAGCC
AGGTCATCAAAATCTGCACGCAAAGCAAACTCTTTGAATA
CCTCCTTAAACCTCCCAGACAACTCGTCTCCTTCTTCAGT
ATTAACAGTGGCTGGACGACCAAGGAAAACAAAGGAGCAA
CTGACCATCCTGAAGGAGTACTTCCAGCACTGCCCATGGC
CAAAAAGTGGCGAATACACAGAGGTAGTGGAACTAACATC
TTTGCCTCGTGCTGATGTTATCCAGTGGTTTGGGGACACT
CGTTACGCTGTAAAAAATGGCCATGTACGTTGGGTGCATG
CTGACGTACGTGAGCAAGTGCTTGCTGAGATAGCAATGTT
ACAAAGTGGAGCTGCCGATGGCAGTGGAACCCCAGGAAGT
GAAGGCAACAGGAAACGTAAGTCACAAGGGAACGGCACAC
CAAAAACACAAAAGTCTGCTGCAGATTCTGTAGATGTGAG
TCCATTAGAGCTATATTTTCGACAGACAGGACCACTGCAA
GAGAAAGACCTTGACAATCTCTGCCGAAAGTCAAAAATGA
GTTACCAACAGGTGCGAGACTGGTTTGCATCTAAAGACAG
TACAACACTGGACACAGAGCTCACTGTTGCTGATTGA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
homeza-201 Contained in:
OTHER homeza-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000002045 (1)
  • Ensembl_Trans:ENSDART00000042100 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF160655 (1) 714bp
    GenBank:BM889988 (1) 644bp
    GenBank:AL730858 (1) 641bp
    GenBank:BI876585 (1) 628bp
    GenBank:AW422781 (1) 622bp
    GenBank:AI877850 (1) 607bp
    GenBank:BI884891 (1) 583bp
    GenBank:BQ420132 (1) 452bp
    GenBank:AW423253 (1) 435bp
    GenBank:AA495250 (1) 421bp
    GenBank:AL719937 (1) 356bp
    GenBank:AL729907 (1) 350bp
    CITATIONS (2)