Transcript

tescb-201

ID
ZDB-TSCRIPT-090929-5296
Name
tescb-201
Previous Names
  • tescb-001
  • zgc:77891-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021681 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021681|OTTDARG00000017951|ZDB-GENE-040426-1903 tescb|OTTDARP00000018244 CH211-169J7.4-001 LG_ BX004981.4 Danio rerio protein_coding KNOWN, 1801 bp
GCCACAGAGCAATTTGCATGCGTTTGTTCTGCAAGGCAAA
CACTGGTGTATGAGTGAAATCTAAACCACCGGAAGATCGA
GGAACAGAGTCGCACACACGCTTTTTGGTGTTGGATCGTT
ATCGTGATGGGAAGCTTTCAGTCTTTGCCCGATGACCATC
AATATCGAACCTTGTCACAGAAGACAGGATTTTCACTGGA
GCAGATCGGAATCCTCCACAATCGCTTTAAGCAGCTCAGC
CAAAACGAGGATACACTACGGAGAGATGATCTTAAAACAA
TCCAAGACCTTGAAAGCAACCCAATTCGGTCCCAGATTAT
AGAGGCTTTCTTTGATAAAAGGAACTTCCAGAAGGATGCA
ACAGGATCTGTGCAAGAAATCGGCTTTGAGGAATTCCTTA
CAGTCATGTCGTATTTCAGAGCTCCAGCCCATCAAATCAC
AGAGGAACAGAGGGAAGAGATCAGGAGAGCCAAACTGCGC
TTTCTGTTCAACATGCATGACACTGACAATGATGGAACCA
TAACACTGGAGGAATACAGACATGTAGTGGAGGAGTTGTT
GTCCCGGAGTGGAGCTCTTGGCAGAGAGACAGCAAAGGGC
ATTGCAGATGCTGCAATGCTGGAGGTTGCCAGTATCACCG
TAGGTCCCATGGCACCTGATGAGTTCTATGAAGGAATAAC
ATTTGAGCAGTTCCTGAAGATTCTAAAAGGAGTTGAAATT
GAGACGAGGATGCACATTCGCTTCTTAAACATGGACACAA
CTGTTCTATGCAAGTAACAATCTGTCTAAATACTGCCAGT
TAAATATTTATTTTTGTTAAAAAGCACTTTAGCAGATGCG
GTTGTTTTTACCCAAGCCTAGTACTATTTGCAGGAATCTC
AGTGTGTGTGTGTGTGTGTGTCTTAGTTAGTTAAAAAGCA
ATAACAAAAAGTATCTTGATATATTCAAATTTCTTGCTTT
GCATGTTCATATTATATAATTATTATATATTAATACAATA
CAATTACAGCTATGCAGGCATATATTTATTTATTTAATAA
ATTATCTTTTCTAAATACCTCTTTATGCTAATATAATCTA
TTAAAACCAAATGAAATCATCTACTGTATATTTTCACATT
ACTATATGAATATTAAATAATGCATCAAATTATTAACACT
GTGAAGTAGCTATATATGAGTAGTATTTTATATGCTGATG
ATTTAATTCTTATAAATTAAAAGTAGTTGAATGTAGAGTC
TGAAGTGAAGAACTGCAGTTCCTCCTGTCAGCCAGCAGAT
ATTGCTAATGCCACAGCTTTGTTTGTGTCAGTGGACATAC
ATTTACTCAGGTACCTGTACAACCAATAAGCATGCTTCAG
CATGTTCGTGTAAGGGCAACGATAAGTGTATTAACTAGCG
TTATATTGTAAACAATAGAAAATATTCTAAAATACCTATT
AACAGCGTTACAATGATAATCTGCACTTGCTAGTGGACAC
CAAAGACCTTTAATCATTAACATTAGAAGCCACGTATAAA
CTTTGATGCAAAGAGCTCAATATGTAGTGTCAGCATGGAT
TGTACACATGTAGGTTTGATGTCGGGAAAATACTTTGCAT
AATGCATTTTTACTTGCAAAAATGAAACTACTCTAGCATT
TACTCTGTGAAAGGGTAAAAATGTCTCAAAATGAAGAAGT
GAACAATTGTTTCTTCTCCTAACCTAAAAAAGGGGAAAAA
AGAGGGTATATGCACCCACTGTGTATTGAATCCGCAACTT
GCATTTACCACAATAAAACGGCATTTTTGCCACACTGAAA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations