ZFIN ID: ZDB-TSCRIPT-090929-5296
Transcript Name: tescb-201
Previous Names: tescb-001, zgc:77891-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021681 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021681|OTTDARG00000017951|ZDB-GENE-040426-1903 tescb|OTTDARP00000018244 CH211-169J7.4-001 LG_ BX004981.4 Danio rerio protein_coding KNOWN, 1801 bp
GCCACAGAGCAATTTGCATGCGTTTGTTCTGCAAGGCAAA
CACTGGTGTATGAGTGAAATCTAAACCACCGGAAGATCGA
GGAACAGAGTCGCACACACGCTTTTTGGTGTTGGATCGTT
ATCGTGATGGGAAGCTTTCAGTCTTTGCCCGATGACCATC
AATATCGAACCTTGTCACAGAAGACAGGATTTTCACTGGA
GCAGATCGGAATCCTCCACAATCGCTTTAAGCAGCTCAGC
CAAAACGAGGATACACTACGGAGAGATGATCTTAAAACAA
TCCAAGACCTTGAAAGCAACCCAATTCGGTCCCAGATTAT
AGAGGCTTTCTTTGATAAAAGGAACTTCCAGAAGGATGCA
ACAGGATCTGTGCAAGAAATCGGCTTTGAGGAATTCCTTA
CAGTCATGTCGTATTTCAGAGCTCCAGCCCATCAAATCAC
AGAGGAACAGAGGGAAGAGATCAGGAGAGCCAAACTGCGC
TTTCTGTTCAACATGCATGACACTGACAATGATGGAACCA
TAACACTGGAGGAATACAGACATGTAGTGGAGGAGTTGTT
GTCCCGGAGTGGAGCTCTTGGCAGAGAGACAGCAAAGGGC
ATTGCAGATGCTGCAATGCTGGAGGTTGCCAGTATCACCG
TAGGTCCCATGGCACCTGATGAGTTCTATGAAGGAATAAC
ATTTGAGCAGTTCCTGAAGATTCTAAAAGGAGTTGAAATT
GAGACGAGGATGCACATTCGCTTCTTAAACATGGACACAA
CTGTTCTATGCAAGTAACAATCTGTCTAAATACTGCCAGT
TAAATATTTATTTTTGTTAAAAAGCACTTTAGCAGATGCG
GTTGTTTTTACCCAAGCCTAGTACTATTTGCAGGAATCTC
AGTGTGTGTGTGTGTGTGTGTCTTAGTTAGTTAAAAAGCA
ATAACAAAAAGTATCTTGATATATTCAAATTTCTTGCTTT
GCATGTTCATATTATATAATTATTATATATTAATACAATA
CAATTACAGCTATGCAGGCATATATTTATTTATTTAATAA
ATTATCTTTTCTAAATACCTCTTTATGCTAATATAATCTA
TTAAAACCAAATGAAATCATCTACTGTATATTTTCACATT
ACTATATGAATATTAAATAATGCATCAAATTATTAACACT
GTGAAGTAGCTATATATGAGTAGTATTTTATATGCTGATG
ATTTAATTCTTATAAATTAAAAGTAGTTGAATGTAGAGTC
TGAAGTGAAGAACTGCAGTTCCTCCTGTCAGCCAGCAGAT
ATTGCTAATGCCACAGCTTTGTTTGTGTCAGTGGACATAC
ATTTACTCAGGTACCTGTACAACCAATAAGCATGCTTCAG
CATGTTCGTGTAAGGGCAACGATAAGTGTATTAACTAGCG
TTATATTGTAAACAATAGAAAATATTCTAAAATACCTATT
AACAGCGTTACAATGATAATCTGCACTTGCTAGTGGACAC
CAAAGACCTTTAATCATTAACATTAGAAGCCACGTATAAA
CTTTGATGCAAAGAGCTCAATATGTAGTGTCAGCATGGAT
TGTACACATGTAGGTTTGATGTCGGGAAAATACTTTGCAT
AATGCATTTTTACTTGCAAAAATGAAACTACTCTAGCATT
TACTCTGTGAAAGGGTAAAAATGTCTCAAAATGAAGAAGT
GAACAATTGTTTCTTCTCCTAACCTAAAAAAGGGGAAAAA
AGAGGGTATATGCACCCACTGTGTATTGAATCCGCAACTT
GCATTTACCACAATAAAACGGCATTTTTGCCACACTGAAA
A

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tescb-201 Contained in:
[BAC] CH211-169J7 (1)

Genome Resources: Vega_Trans:OTTDART00000021681 (1),  Ensembl_Trans:ENSDART00000041504 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC065886 (1) 1732 nt
GenBank:CN015115 (1) 951 nt
GenBank:CO812712 (1) 879 nt
GenBank:CN505300 (1) 766 nt
CITATIONS (2)