Transcript

taok3b-201

ID
ZDB-TSCRIPT-090929-5293
Name
taok3b-201
Previous Names
  • taok3-001
  • taok3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000021678 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021678|OTTDARG00000017949|ZDB-GENE-060526-59 taok3b|OTTDARP00000018242 CH211-169J7.5-001 LG_ BX004981.4 Danio rerio protein_coding NOVEL, 2071 bp
AAGCATGCTTGCGTGAGGGATGAGGCTGGAGACAGGGACA
TCAGGCCAGAGCTGCGGCCTTCTTCTTTTCACAAGAGCCG
GGCTCGCCATCATCGCAGCAGCAGCAGCAGCATCCGCCAA
CGCTTTGCCATCATCACACCAGCATCTTTGGTCTGTGAGC
AGATCCAGGAGCATGAGCAGGAAGCTGTGTGGCGCGAGCA
GATGTCAGGGTATAAGCGCATGCGGCGGCAGCACCAGAAG
CAGCTGATCGCCCTGGAGAACAGGCTAAAGGCCGAGATGG
ATGAGCACAAGCTCCGGCTGCAGAAGGAAGTTGAGACCCA
GGCCAATAACACCTACATCGAACTGGAACGACTAGCCAAA
AAGCAAGCTACACAACTGGACAAGGAGATAAAGGCCACAG
CAGCTGAGGAGAAAAGAATCCAGCAACAGATCTTGGTCCA
GCAGAAGAAGGAACTGACCACCTTCTTGGACACCCAGAAA
AAGCAGTACAGACTATGCAGAGAAAGAATGAAAGAGGAAA
TGAATGAAGACTTCGATACACCAAAAGAGGAGAAACAAGA
GCGCTTGTCACGGCATAAGGAAACAATGCAGCGCTCCCAG
GCTGAGGAGGAGGCCCAGCTGTTGAACCAGCAAAGACTGG
TTTACGAAAGGAGCTGCCGTGCTCTAAAAAGAAGAAGCCT
TATCAAGAAGCACGAGTTTGAACAAGAGCAAATACGGGAG
GAGCTTAACAAGAAGAAGATGCAAAAAGAAATGGAGCATG
CATTGATGATCAGACAGGATGAGTCCACGCAAGAGCTGGA
ACAGCGGCAACTACAAACCTTACAAAGGCTACGCTTCGAG
CTGATGCGGCACCAGCATCAAACTGAGCTGGAGAACCAGG
AGGAGTACAACAGTCGACGGCAGAGGGAGCTACACAGGAA
GCATGCACTGGAACGCCGACAGCAGCCCCGGAACCTGAAG
ACACTGGAGATGCAGATCAAAAAGCAATTCCAAGATACCT
GTAAGGTGCAAAACAAGCAGTACAAAGCTCTGAGGAACCA
TCAGCTGGAAGTCTCCCCGAAGGGTGACCACAAAGCCATC
CTGAAGTCTCTAAAGGAGGAACAGACCCGCAAGCTTGCAC
AGCTGGCAGAACAATACGAGCAAAGCATCAATGAGATGAT
GGCCTCACAATCGTTACGTTTAGATGAAGAGCAGGAGGCC
GAATGTCAGGCTTTACGGCAGCAGCTACATCAGGAGATGG
AGCTCCTCGATGCCTACCAGAACAAAACGAAGGCGCAGAT
GGAGGCCCAACATGAGCGTGAGGTGCAGAAGTTGGAACAG
AAGGCGTCTTTGCGCCGGGCTCACTTGGAACAGAAGATTG
AAGAAGAGCTGGCCTCACTTCATAAGGAACGAACAGAAAA
AATCAAGCATTTATTTGAGCGCCAGGAGCGAGAACTGGAG
ATGTTTGATTTGGAAAGCGCACGGTTAGGATTCGGAAGCT
TGGCCTCGTTTGACTTTCCCAAGGACGAGGCCAGATGATC
CAACAGAAGCGGAGGGGACTGTTCAACGCTGATGTCTTTG
GACACATTGTGCCTGCACTGTCCCTGATTGTTGGATTTAC
CAAGATCACCCAAACAGTGACCATGCTGGATCAATGTCTT
ATAACTCTTTATCGGCTGAAATTCTTGAACGAGCGGAGAA
ACTTAACAGCCACAGACACAAAAGTGGTTTGCTGGTGCAT
CATAAACCGAGACGAACCATCTAGACGAACCGACCTTTTC
TCCATGCCATCGTCCCACTTTTGGTATTCAATTAGTAATT
CAGGATATTTTAGTACAAGTAAGCACTTTGATATGTTAAG
TACGATCCCATCATGTAAGGTGGATATGAAGTGTGAAATG
CCTTTGGTGTCATCAAAGGACATTGTGACTGTAGAATGTG
TCCTGCGTCTTCACCGTGGCTATTAGCTGTTTTGTACGTA
TCACAGCGAATGTGACAACTGTTGATGAAAACTTTGCGCA
GAAGCCGATTTTGAAGCAGTGTCTCATTTGAAAATATGGT
GACTACATTAAGAGCATCCGATTGATTTCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations