ZFIN ID: ZDB-TSCRIPT-090929-5292
Transcript Name: cabp7b-201
Previous Names: cabp7b-001, si:dkeyp-15f12.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021677 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021677|OTTDARG00000017948|ZDB-GENE-060526-366 cabp7b|OTTDARP00000018241 DKEYP-15F12.3-001 LG_ BX004981.4 Danio rerio protein_coding NOVEL, 642 bp
ATGCCAGTGCGTGCTGTGACTTCCAGGTTCATGTACAGGG
GACTTTGCTCAATTCCAGATATCCTTTCCTACAGGGCTCC
CGTCAGCCTCCCCGAGGATGAAGTGGAGGAGATCCGTGAA
GCCTTTAAGGTGTTTGACCGTGATGGGAACGGATTCATCT
CCAAACAGGAGCTAGGAGTGGCCATGCGGTCTCTTGGCTA
CATGCCAAATGAAGTGGAGCTGGAGGTGATCATTCAAAGA
CTGGACATGGACGGTGACGGTCAGGTTGACTTTGAAGAGT
TTGTAGCGCTCCTCGGACCAAAGCTGTCTTCAGCTGGTAT
GCCAGACCGCTTCCACGGAGCTGAATTTGACTCCATATTC
TGGAAGTGTGACATGCAAAAGCTAACTGTGGACGAGCTGA
AGAGACTCCTGTATGAGACCTTCTGTGACCATTTGACTAT
GAAAGACATCGAGAACATCATCATGACTGAGGAGAGTCAC
TTAAACAGCCCGGAGTGCCAAGTAGATATTGACAAAAGTC
CCATGCAACAAGTCAAGCACACCTGTGTGCGAAAGAGCTT
GATTTGTGCCTTCGCCATCGCGTTCATCATCAGCGTCATG
CTCATCGCAGCCAATCAGATGCTTCGAAGAGGAATGAAAT
GA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cabp7b-201 Contained in:
[BAC] CH211-169J7 (1)

Genome Resources: Vega_Trans:OTTDART00000021677 (1),  Ensembl_Trans:ENSDART00000086181 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)