header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-529
Transcript Name: btbd7-202
Previous Name: btbd7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005693 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005693|OTTDARG00000005253|ZDB-GENE-030131-4477 btbd7|OTTDARP00000005082 btbd7-001 LG_none BX284625.4,BX255913.8 Danio rerio protein_coding KNOWN, 3905 bp
GGAGGATACAACACAACATGTAATATTTGCTGACGGGAAA
CTGAGAGCACAGACTCAATTTGAGCTGTTTTGTTGTTGAA
CGAGGTATTAAAAGCGAGTAATGTAGGGCGGATGTTGTAT
CGTAAAAGTACTAGCAGCTTGCTAGCGCTTCATATATGTG
TTTGTATGTGTGTATGTGTGTGTGAACCCGGGACGTGCAG
AGCCCTTTTTTTACTCTATATCACTCCACGAAAGAAAAGT
GCAGGCAAATTTGCTCGGCTAAGCAAATATCAAAAGTCGC
TGGCTTGGATTTTGGCTCGTTTTATGAGCAAGAAGAGAAG
AGAGGAGCAGTAAACTTGACTCAGGAATGACGGACATTGC
TGCAGTGCTGCCCAATTCATACATGTCTGATTGAGCAGAG
GGGTAAGCAAGTCAGTGCATCGACGCTCAGACGGAATGAT
CCAGCAGGGTGAATAAGAGGAGGAAGAAGGGGGGAGAGGA
TGGGTGTGAATGCCTCCAGCTACCCTCACTCGTGCTCCCC
TCGATTTGGGGGAAACCCACAGACCCAGCAGACCTTCATT
GGCGCCTCCTATGCACCACAGGGTTATGGCGGAGAGTCCA
AGCTCTACAGCCTAGAACATGGCCCTGAAAAACCTCAGGA
CAAGAAGAAAAAGAGCTCTGGTTTGGCCACGCTCAAGAGG
AGATTCATTAAGCGACGCAAGTCGAGTCGGTCGGCTGATC
ATGCACGGCAGATGCGAGAGCTCCTCTCCGGGTGGGATGT
ACGTGATGTCAACGCTCTGGTGGAGGAGTATGAGGGCACA
GCAGCTCTCAAAGAGCTCAGTCTGCAGGCGGGCTTGGCCC
GACCTGAAGCTCGAACCCTACAGCGTGATTTGGCTACCCT
TTATCAGCACAAGTACTGCACTGACGTGGACCTGATCTTC
CAGGATTCCTGCTTCCCAGCACACCGGGCCATTCTGGCCA
CCCGCTGCCCATTCTTCAAAACCCTGCTATCGTCATCACC
AGGTTACGGGGCAGAGGTGTTGTTAGATGTTGGGACCGCA
GGCATGGATGCACCCATGTTCTCCTCTTTGCTACATTACC
TCTATACAGGTGAGCTGGGCTCCGATGACGCAAGGTTGCA
GAACGTGGATGTGCTGGTGAGACTAAGTGAGGAGTTCGGT
ACGCCCAACTCCTTAGAAGCTGACATGCGAAATCTCTGCG
AGCATATGCCCTATTTTGACTCACTGCTGAGCTTTTCCTC
GGATTCTGAGTTGGTGGAGGCTTTCGGAGCAGGTGGACCT
GCTCCTAGCAGTATGGGAAGTGGAAACATAGGGGCGAGCC
ATGGCTCACCTGATGAGGAGCTGAGGGCCCACAAAGCCGT
ACTGTCAGCACGCTCGCCATTCTTTCGCAACCTGCTGCAA
CGACGCATTCGCTCGGGTGAGGAGATCACAGAGCGCACTC
TGCACACCCCCACCCGAATCATCCTTGATGAATCGATCAT
TCCCAAGAAATACGCCCGTGTGGTCTTGCACTGTATGTAT
ACGGATGCAGTGGACCTTTCTCTGGTGCTGCGCGGGAGCC
CTTCCGAAGGCAGTCTGGGTGAAGTTCAGGCACTGGTGGC
TGGAAGAGGATGCATGAGCCGGGCTGAAGAGGCCATGGAG
CTCTACCACATCGCTCTCTTCTTGGAGTTCAGCATGCTAG
CTCAGGGCTGTGAAGACATTGTGGCAGACAGCATCTCTCT
GGACTCGGTGGTGGCCATCCTGAAGTGGAGCTCACAGCCC
TATGGGTCTAAATGGGTTCATCGGCAGGCCATGCACTTCC
TGTGTGAGGAGTTCAGCCAGGTCATGACCTCGGACGTCCT
CTACGAGCTGAGCAAGGAGCACCTACTGGCGGCCATTCAG
TCTGACTATCTGCAGGCCAGTGAGCAGGACATCCTGAAGT
ATGTTGTAAAGTGGGGCGAACACCAGCTCATCAAGAGGAT
GGCTGATAGAGAACCTAACCTGTTAAGTGGTACTGCACAT
AGTGTGAATAAACGTGGCGTGAAAAGAAGGGATCTGGACC
TAGAAGAGCTTAAAGAGATTCTCTCTCCGCTGCTGCCTTT
CGTCCGAACTGAGCACATATTACCTGCCAACAGTGAGGTC
CTCTCTGACACGATGAAGAGGGGTCTGATCAGCACCCCTC
CATCTGACATGCTGCCCACAGCAGAGGGAGGCAAAGCCAA
CGCCTGGCTCCGGCAGAAGAGTGCTGGCATTTATGTGCGC
CCACGCCTCTTCTCTCCTTATGTGGAGGAGGCCAAGGCGG
TTCTGGAGGAGATGATGGTTGAGCAGACCGATCTGGTTCG
GTTGCGCATGGTTCGTATGTCCAACGTGCCTGACACACTG
TACATGGTGAACAATGCCGTCCCCCAGTGCTGTCACATGA
TCAACCACCAGCAAATGGCTGGCAGCCAATCAGCTCCGCC
GTCTGTGGTTGCTAATGAGATACCAGTGCCCAGGTTGGCA
GTAGTGAAGGAAATGATCCGTAGGCTGCAGGAGCTGCGTC
ACACAGATCAGGTGCAGCGAGCATTTGCTCTGAACTGTGG
TGAAGGCGCTACAGTGAGCTATGAGCTGCAGATCCGTGTG
CTCAGAGAGTTTGGCCTGCCAGACGGGGCTGCTGAACTCC
TACAGAATCCGCACAAATTCTTTCCTGAGGAACGTTTTGG
AGACGAGAGTCCCGTTTTGGCCCTGCGCCAGTCAGGTCGC
TGCCGGGTCAATAGTACACCAGCTGTGGAGAGCATGTTCA
CAGACCTGGAGGCTCTGGTGGGCTTCCACCCCCCTCTGCC
CCCACCTCCTCCCCCCTACCATCCCCCCACCACCCCGGGC
CATGGCCAGCAGCAATTTAAAGCAGGCTGGAGACCTCGGG
TCCCCAGCCAGCCTCCTTCCAGATCTTTCTCCTACCCCTG
CAATCATGCACTCCTTCACAGGCAGGCCTCTTCCAAAATG
GGCAGCCCAGTCTATCCTCCTGGAGCCAAGCCTCTGCCCC
CAGACTGCACAAATGCACAGGGAGGGAGGAATCTTCATCC
TGACAAGCAAATGAATATGGAGCCTGTTATCAACGAGTTC
ATGCCGGACATCGCCATGGGTGTTTCAGCAATGACCCTAA
AGGAGCGGCGGCTTCCAGAGGTCTCTATGGAGGTGGAGAG
TCATGAACCTTCTCACCCTCACCTTTCCACAGCTCCTCCA
ATGTCCCACAGCTACTCCAACCGTCACCCACACTCTTCCC
GCAAGCGGCACGCAGCCGAACCCAAGCCAGAGGGTCCGCA
GCCTGACTTCCCAGATCTCTACGAGTTCCCAGGGCGCCAT
GTGCCTCCATACAGTGGGCCAGATCTCTACATCCACGGGC
GTCAGGCAGGCGGAGGAGCACCTCCTCCATCCTACTCTGA
GGCTTCAGAATCGCTTCGCCTGGATGTGCTGGAACAGCCT
CCACAAAGACTAGACTTGGCCATTGTCTCACAAGGCAGTG
TTGTGCAAGCCATTCAGAGGCCACGGCCTATAAACGAGAC
TGACCTCACCTGTGGGCTCGGCCCTTCCACAGAACAGTAT
GAGGAATGGCCCACGGGTCGACGACCCCCTCCTGAGGGAA
TAGGGTTGGGTTTAGGGGCAAACGTAGGGACTGGGGATGA
GGGAGGGTTGGGGGCGCGAGACCGCAGATCCCCCAATAAA
CCCGAATACCCCTACAGGAAGTCTGCTCTCTGACCCCTGA
TAAAAAGAGACTGAAGACTGATTCAAATACTAAGTGTAAG
CTAACAGGTGAGGCACCAGCAGTCCTGCACTTTGTGTTCT
TTCAAAGGCTGACAGTATCTTGAAGTGATGAACGCCCATA
AGCTACTCGAGTGGCTGCTTTTCTGATGACTGAAGGGAGA
TGTCATGTGAAACTGCTCTAGATTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
btbd7-202 Contained in:
OTHER btbd7-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005693 (1)
  • Ensembl_Trans:ENSDART00000149024 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM103068 (1) 601bp
    GenBank:AI959375 (1) 483bp
    GenBank:BI476036 (1) 435bp
    CITATIONS (2)