ZFIN ID: ZDB-TSCRIPT-090929-5289
Transcript Name: scai-201
Previous Names: scai-001, si:ch211-169j7.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021674 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021674|OTTDARG00000017946|ZDB-GENE-060526-57 scai|OTTDARP00000018238 CH211-169J7.1-001 LG_none CR925807.5,BX004981.4 Danio rerio protein_coding NOVEL, 1936 bp
AATTCAACTGGCCAGACTGAACCGTCGACCGCAGCAGATG
CCGAATGGCAGATACTCCCTGCTTTTCCCTGGGAGGGTGA
TTTGAATGAGTTGGATGTAAATGACGGTGCGCCACCGCAC
TGGATGTCTAGATTTGTGTCGGGGAGAGATTTACAAGCGC
GCGCTACCCGGAGACGCCGTTCTTGAGGAGCTGAAACAGA
AGAAGCTGCTCTGAACTACATCAGTCTCAGCAGCTGCCAT
GACAGGGGTGGGGGCAGAGGATGACATCCCTCTCTGTGAG
AGGAAAACTGTCACTGACTTCTGCTATCTCCTGGACAAGT
CCAAGCAGCTTTTCAATGGCTTAAGGGATCTGCCTCAATA
TGGACACAAGCAGTGGCAGTCCTATTTTGGCCGAACGTTT
GACGTCTACACCAAGCTGTGGAAGTTTCAGCAGCAGCACA
GACAAGTCCTGGACAACCGGTATGGTCTCAAGAGGTGGCA
GATAGGTGAAGTGGCCTCAAAAATTGGCCAGTTGTACTAC
CATTACTACCTCCGCACTTCAGAAACAAGCTACCTAAATG
AAGCCTTCTCTTTCTATTCGGCAATTCGCCAACGGTCATA
TTACCACCAGGTCAACAAAGAAGACAGGCCAGAGCTGGTT
GTAAAAAAGCTGAGGTATTACGCTCGGTTTATCGTTGTTT
GTCTGTTGCTCAACAAGATGGACCTGGTTAAGGTGTTGGT
TAAGGAACTTTCGGAGGAGATTGAGGACTACACCCAGCGC
TTCAACACTGAGGACCAGTTAGAGTGGAATCTGGTGCTGC
AGGAAGTAGCAGCTTTTGTGGAGGCCGATCCTCTGATGAT
CCTGAATGATGACAATGCTGTGGTGGTCCTTTCCAATCGG
CTGCAGGAGGGAGGTGTGCCCCCTCTGGAGCAGGGCATGG
TGGTTGGCCAGCTCACCTTGGCAGATGCTCTCATCGTTGG
CAACTGTAATAACCAGGTGAAGTTCAGCGAGCTGACCATC
GATATGTTTCGAATGCTTCAAGCGCTTGAGAGGGAACCGG
TGAACCTGGCTACGCAAAGCTCCAAACCAGGGACACTTGA
GCCCAATGAAAAGCCGGCCAAGAGAGAGAACCCTCATAAA
TATCTCCTCTACAAACCAACCTTCAGCCAGCTCTACACTT
TCCTGTCTGCCTCCTTCAAGGAGCTGCCGGCCAATAGTGT
CCTGCTGGTGTATCTCTCTGCCACTGGAGTTTTCCCCACT
GGACGCTCTGAGAGTGAAGGACCTTATGACTTTGGAGGTG
TCCTGACCAATACTAACCGAGATGTGGTGAATGGTGAGAC
GGTGCAGAAAAGAAACCAGGCACAAAAAGAGATGCACTGC
CTCCACCCAGGAGACCTTTTCCCCTTCACTAGGAAACCTC
TGTTTATCATTGTCGACTCCTCCAACAGCACAGCTTATAA
GAATTTCTCCAATCTGTTCGGCCAGCCCCTTGTTTGCCTG
CTTTCTCCAACAGTATATCCGAAGAGCATGCAAGACCAGT
CTCAGCGTGGGAGTCTGTTTACTCTCTTCCTTTACAACCC
CCTCATGGGCTTCCTATCTGTCTGTGGACTGAGCAGCATG
CGTTATGGATTGTGGGAAAAAGCCCAGGAACTCCTGCGGA
AGGTTTTCCATGACATTGGCCAGATGATCACAAGTTCACG
AGTTATAGATCAGGCGTATCTGCAGTTTTATGGTGATGAG
TTTCTGCGTCTGCTTATGATCCGCTTCGTGTTCTGCTCCT
CCGCGCTCCGGTTACACAAGCTCTTCCGGGAAGCGAGGAG
TTTTCCAGAATCGTATCCCCCTCTGCCAAAACAGGAGATG
GTGGAGAGCAGCCTTCTACAGAAACATGTGCTGGAGCTGG
CGGCTATGCTGGACGTGCAAAACCTCTTTTCCGATGGCAT
GCTGGATAACTATTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
scai-201 Contained in:
[BAC] CH211-169J7 (1), DKEYP-15F12 (1)

Genome Resources: Vega_Trans:OTTDART00000021674 (1),  Ensembl_Trans:ENSDART00000139744 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI891522 (1) 665 nt
CITATIONS (2)