Transcript

spns3-202

ID
ZDB-TSCRIPT-090929-5282
Name
spns3-202
Previous Names
  • spns3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021638 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021638|OTTDARG00000017922|ZDB-GENE-060531-7 spns3|OTTDARP00000018212 DKEY-193H7.6-001 LG_ CR753844.7 Danio rerio protein_coding NOVEL, 1902 bp
ATGGCCTCTGACCAACACAGACCAAAACCCAGATTGAGTC
TCCGCTCCAGCACAACTATACGATACGGCTCCATGAGCTC
TGAGCATCCGGATGGAGACCCTTCCACCCCGCAAACAACC
TCCATCTCTCAGAGACGCTCCTACATTGCAGTGGCAGTGC
TGTGTTACATCAATCTGCTCAACTATATGGACCGTTACAC
TATAGCTGGTGTGCTGCTTAGAATACAGAAATTCTTTTTC
ATCTCCGACAGCACATCGGGCCTCCTACAGACAGTTTTTA
TCTGCAGCTTCATGTTCTTGGCACCAGTGTTCGGTTACCT
TGGAGATCGCTATGATAGGAAGCTTATTATGATCGTTGGG
CTGGTTATGTGGATCGTCACAACACTGGGAAGCTCTTTCG
TCAGAAAATCGCACTTCTGGGTTCTGGTTGCGACAAGGGC
TTTGGTCGGGACAGGAGAGGCCAGTTACTCCACCATTGCT
CCTACTATCATTGGTGACCTGTTCGCTGGCTCCAAGAGAA
CTCTTATGATCTCCTTCTTCTACATCTTCATACCAGTTGG
AAGTGGTCTTGGATACATTATTGGGGCAACTGTAGCTGAT
GCAACAGGAGACTGGCGTTGGGCTCTAAGGGTTAGTCCTG
CTCTTGGGGGACTTGGTTTGCTGCTTCTGGTGTTTCTTAT
ACCTAACCCTCCTCGCGGAGCATCAGACAATGGAGGAGCA
AACATGGAAACCACTTCATACACTGAAGACATCAAATACC
TCTTAAAGAACCGGAGTTTCGTCTGGTCTTCTCTCGGCGT
TACTGCCATGGCTTTTGTCACCGGGGCTCTGGCTTTCTGG
ACGCCCACCTTTCTGTCTCGTGCACAGGTCACACAGGGTC
TCAAACAACCCTGTAAAGAAGAGCCCTGTGACTCTGTGGA
CAGCTACATTTTTGGAGCAATCACAGTGGTGACAGGGGTT
GTGGGGGTGTTTCTGGGCACCTGCATTTCCAAGAAGCTGA
GAGACCGAGTGCCGAACGCAGACCCGCTCATCTGTGCCGT
AGGAATGCTCAGTTCCTCACCTTGCTTCTTCATTGCTATA
GTCCTGGCCTCCACCAGCATCCCGGCCACTTATACATTCA
TTGCTATTGGAGAGACTCTGCTGTCACTCAACTGGGCTAT
TCTGGCAGACATTCTTCTGTACGTAGTGGTGCCTAATAGA
AGAGCGACAGCAGAGGCCTTGCAGATTATGGTCTGTCATC
TTCTTGGAGACGCAGGAAGTCCATACCTTATTGGTGCGAT
CTCAGATTCTTTGAGTAAGTATAATACCACAGACCCCAGC
TGGGATTTCCGCAGATTGGAGTATAGTGTTCTGCTGTGCC
CCTTCATTGGGGTCCTGGGAGGGCTGTTTTTCCTCATGAC
CTCTCTGTATATCAAAGAGGACCGGAAGGCAGCAGAATTG
CTCACTTCAGGACAGACTCCTCAACCAGAAATAACCACAG
TCTCAGAGTCGGTCTGACCATGAAAACAACAACCCTGAGA
CCTTGAATAAGCTTTGATACATCAAGCAGACACATGTTAA
TACATATGGATACACGGACAATGAGAATAAAGGCTTCAGG
AACACTGTAACAGAATAAAAGTAACATGTAAAAGTTTACA
TGGCAAAGCACTTAGCATCTTACTGAGACAAAAGCACATT
AGCTCCATTTGTTACACGTTTAAAGGCAAGACAATGCAGG
TTAATGAGGTATAAATATTAACTAATAATTATCACCATAC
TTTGATAGCACGTTTTATAAAATGGTGTATTCATTACGCA
ATTGAAGCATTCATCAAATAAATAGGTGCTAATTTGCATA
CAGTTGTAGCACATACAGTACCTCTGAACAAAGTGAATTC
AGATTCAAGGTTTTTTTACTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations