Transcript

ankfy1-201

ID
ZDB-TSCRIPT-090929-5271
Name
ankfy1-201
Previous Names
  • ankfy1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021627 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021627|OTTDARG00000017913|ZDB-GENE-041222-1 ankfy1|OTTDARP00000018204 DKEY-193H7.2-001 LG_ CR753844.7 Danio rerio protein_coding NOVEL, 4905 bp
ATGCGCACAGAGGAGGTGCAGAAACTGCAGAAGCACCTTG
CTCTGCTGAGGCAAGAGTATGTGAAGATGCAGCAGAAACT
GGTGGAGACGGAGAGGCGCTGCTCTGTTTTGGCTGCTCAG
GCTTCTGTACCCGGCTCCTCCTCTCAGGCCAGTGACTCCT
TCATCAGTCGCCTGCTGGCCATCGTCTCTGACCTCTATCA
GCAGGAGCAGTACAGTGATCTAAAGGTGAAGATTGGAGAC
CAGAGGCTCAGTGCTCATAAATTTGTACTGGCTGCTCGCA
GTGAAATCTGGAGTTTAGCTAACCTGGCTTCCACCTCAGA
ACTGGACCTCTCAGATGCCAAACCAGAGGTGGCGATGGCA
ATGCTGCGCTGGACATACACGGATGATCTGGAGTTGAATG
GGAATGATGGCTTTCTCATTGACCTGATGAAGTTAGCCAA
CCGCTTCCAGCTCCATCTCTTGCGAGAAAGATGTGAGAAA
GGAGTGATGTCATCAGTGAACGTTAGGAACTGCATCAGGT
TTTATCAGACAGCCGAAGAGCTGGACGCCGCAACATTGAT
GAACTATTGCGGAGAGATTATTGCCAGTCACTGGGATGAT
CTGCGGAAAGAGGACTTCAGTACCATGGATGCTCAACTTC
TCTATAAGATGATCAAATCTAAAACCGAGTACCCTCTTCA
CAAAGCTATTAAAGTAGAGCGAGAAGATGTGGTCTTCCTT
TATCTAATAGAGATGGATGCCCAGTTACCAGGAAAGCTGA
ATGAGCTGGACAATAATGGAGACTTGGCGTTGGATCTGGC
TCTGTCCAAGAAGCTGGAGAGCATCGCCACTACACTGGTC
AACAACAAGGCAGATGTTGACATGGTGGACCAGAGCGGCT
GGAGTCTTCTACATAAGGCAATCCAGAGAGGGGATGAATT
TGCCTCCACTTTCCTGATCCGTCACTCGGCACAGGTCAAC
GCTGCTACAGTTGGGGCTGTGGAGACACCTCTGCACCTGG
TCTGCTCTTTCAGCCCTAAGAAACACAGTGGTGAGGTTAT
GGCTGGCATGGCACGCATCGCTGAGGCTCTGCTCAAAGCT
GGTGCCAACCCCAACATGCAAAACAGCAAAGGACGGACGC
CACTACATGAGGCTGTGGTGTCAGGAAATGAACCGGTCTT
TAATCAGCTTCTGCAGTGCAAACAGTTAGACTTGGAGCTA
AAAGATCACGAAGGCAGCACTGCACTCTGGCTGGCCCTGC
AATACATCACTGTGGCCTCTGACCCCTCTGTTAACCCTTT
TGAAGACGAGGCTCCTGTTGTGAACGGCACTTCATTTGAT
GAGAACAGCTTTGCAGCACGGCTTATACAGAGGGGGAGCA
ACCCTGATGCTCCGGACACTAATGGCAACTGCCTTATGCA
GAGAGCAGCAGTCGCAGGAAGTGAAGCAGCTGCTATCTTT
CTGGCCACACATGGAGCTAAAGTCAATCACACCAACAAAT
GGGGAGAGACGCCTCTCCATACGGCTTGCCGCTGTGGCCT
GGCAGGACTGACAGTAGAGTTACTTCAGCAGGGGGCCAAT
CCTAACCTGCAGACGGACATCGCTTTGCCCGGTGGAGTGG
AGAAGAGCCAGGGGGTCTCCCAGCAGAGCCCGCTCCACCT
GGCCATTGTTCACAACCATCCGGATGTGGTGTCTGTCATA
CTAGAACAGAAAGCCAATGCGCTACACGCTACCAACAACC
TGCAGATCATCCCTGACTTCAGCTTGAAAGACTCCATGGA
TCAAACCGTTCTGGGTCTTGCTCTCTGGACTGGTATGCAC
ACTATTGCTGCTCAGCTGCTAGGCTCTGGAGCAGCCATTA
ATGACACCATGTCTGATGGACAGACGCTGCTTCACATGGC
CATCAAAAGACAGGACAGCAAAAGCGCCCTCTTCCTGCTG
GAGCATCAAGCCGATATCAATGTCAGGACCCAGGAGGGGC
AGACGGCTTTGCAGTTAGCCATCAGTAACCAGCTTCCTTT
AGTAGTGGACGCCATCTGCACCAGAGGAGCCGACATGTCA
GTGGTGAATGAGAAGGGGGATCCTCCACTCTGGCTGGCTT
TGGAGAACGGTTTGGAGGACATTGCATCAACATTGGTGAG
ACATGGGTGTGACGCGACCTGTTGGAGTTCAGGGCCGGGA
GGATGTCAGCAGACTCTTCTCCACAGAGCCATCGATGAGA
ACAATGAGGTCACCGCCTGCTTCCTTATACGCAGTGGCTG
CGATGTGAACAGCTCGAGAAGGCCTGGTCCTAATGGTGAA
GGTGATGAGGAGGCGAGAGATGGACAGTGTCCACTACACC
TGGCTGCATCCTGGGGTCTGGAGGAAGTGGCGCAGTGCCT
TTTAGAGTTTGGAGCCAATGTTAATGCACAGGATTCAGAG
GGCCGTGCTCCCATCCATGTCGCCATCAGCAACCAGCAAA
GCGTCATCATCCAGCTGCTCATCTCCCACCCTGAAATCAG
GCTGAATATTCGAGACCGACAAGGCATGACGCCTTTCGCC
TGTGCCATGACCCACAAAAACAACAAGGCTGCTGAAGCTA
TCCTTAAGCGAGAGCCTGGTGCTGCTGAACAGGTGGACAA
CAAAGGTCGCAACTTTCTCCATGTTGCTGTGCAGAATTCA
GACATAGAGAGTGTGCTGTTCCTCATCAGTGTACAGGCCA
ATGTCAACTCCAGAGTGCAGGACAGCGCCAAACTCTCGCC
TCTACACCTGGCTGTGCAGGCAGGATCCGAGATCATTGTC
AGAAATCTGCTCCTGGCTGGTGCTAAAGTAAACGAGCTGA
CCAAGCATCGTCAAACAGCGTTGCATCTAGCTGCGCAACA
GGATCTTTCCACGATCTGCTCCGTCCTGATTGAGAATGGG
GTTGACTTTGCAGCCGTAGATGAAAATGGAAACAACGCAC
TTCATCTGGCCGTGATGCAGGGGCGACTAAATAATGTGCG
TGCTCTACTCACTGAGTCCAACGTAGATGCGGAGGCCTAT
AATTTAAGTCAGTCTCCCATGCATGTCCTCGGCCAGTATG
GGAAGGAGAACGCGGCGGCCATCTTTGAGCTGTTTTTGGA
ATGCATGCCGGAATATCCCCTAGATAAACCTGACAATGAG
GGCAACACAGTACTGCTGTTGGCCTATATGAAAGGAAATG
CTAACTTATGTCGTGCGATTGTGAGGGCTGGAGCTCGTCT
CGGTGTCACTAACAACCAGGGCATCAACATCTTTAACTAC
CAAGTTGCTACTAAACAGCTTCTGTTTCGTCTGCTAGATA
TGCTATCCAAAGAGCCCCCGTGGTGTGATGGATCAAACTG
CTATGAATGTATTACCAAATTTGGAGTCACCACCAGAAAA
CATCACTGCCGCCATTGTGGGCGTCTGCTCTGCCACAAGT
GCTCTATAAAAGAGATCCCCATCATCAAATTTGACCTGAA
CAAACCTGTGCGTGTGTGTGACATCTGCTTTGATGTCCTG
ACCCTGGGAGGCGTGTCGTAACACACCAGAGGAACCTGAA
GGACAGGCGCCAGCCGAGCTGAGCATAAACCCACGGCTTG
GGCCTAACACTATTCAAGGAGGACGCCGAAGAAAGCAAGA
GCTTTTGAACAAAACCATTCCATTCTTGTCAGACGACAAA
ATACAACCATAACAATATGTGTTTGTTCTAGCAGTACTTT
TTAGAACCAAACTATTGTGTGTCGAGGATCCAGATTAAAA
CTAGCGGAATGCAGAAGCAAATTGTAATTCAGAGTGAGAT
GAGAAGGACAGCCGTCATTTACTAGTCATTAAGCAAACAA
TGAACCATATGGGCTTTTATACAGGGCTAACGTGCTACGT
GGACACTTATGATTTATGATCACTTGATTTTTATTTTGTT
TCTCCATCAGAATGACAAAACTAGCACAGGATTCCCACTC
GCCATCACCACTCCAATTGACTGTTTCTACAGACTTGAAG
GTATTCGTTGAATGCTGCTGGATATAAGGGATCTGAAAGG
TAGCCATGTTTAAACATTGAGAAGCCTTAATCATGCAACG
CAGGCTCATTCAGTTGTCACGTTGATATTTTGTACACATT
TTTAGCCTCTCTAGAAAGTGATTTCCTCTGTGGAGTTCAA
ATCTAAACACTAAGAGAGAGACAGATGGAGAAATACACCT
TACTGGCTTTATGTTATGTTATTAGTAACATGATCACGTA
ATCATTTATTAATCTGCATATTCAGTGGACTTTATTTGAA
CTGATCCATTAGAGTTTGCGTCATTCTACTATGTGAGAAT
TTAAATCGTTCCTTGTGATTCTATTAAGTCGGACGGGTGC
AGAAATGCAGGTGAAGGTTTATGATATGCTTCCTATGCAT
ATGCATGACATCATCATCATCAGTTTATTCATTTCTGATC
ACCAAAGGATACATTCCAGTTAATGTTTGCTCTGCAAGCT
GGTGCTGGGGGCGCTGCTCGCTTGGTCCTTGTTTTCAAAA
GTCTCCTTGGTGGCGTATCACGTCACTTCATTTTTTTTAT
TTGATGCTTTTCATGTCCATGCTTAACAGGTGCACTTTAT
CAAGTTCTTTTTTTTAACATTTCGGATCATTTTCAAAAGA
GATTTGGTTTGTTTTCTTTGTTTGTGGGGGGGAGGGCAGG
GGGGAAGGGCGAGTCCACAGTCTGTTATTGGTATTGTTGA
ATTGTACAGATAAATGTATAATATTTTTGACCACTACAAC
TGTTTTGTACTTTACTGCAGGTTGTGCTTTTTTTGTCTAT
GTGACAAACCTACAATTCGGCCTCTGTTTAATCTTCTCTG
CACATTGTATGGTATCTGTATGCTCAGATATTTAGCCTGT
CGCCGCCTCTAGTATCCTTTTCAAGAAAGGGAGGACAACT
TTACATAAAGGACGATTCAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations