Transcript

si:ch211-214j8.12-201

ID
ZDB-TSCRIPT-090929-5179
Name
si:ch211-214j8.12-201
Previous Names
  • si:ch211-214j8.12-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021510 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021510|OTTDARG00000017837|ZDB-GENE-060526-102 si:ch211-214j8.12|OTTDARP00000018107 CH211-214J8.12-001 LG_ BX510923.8 Danio rerio protein_coding NOVEL, 2354 bp
ATAACGAGGAAAGAAGAACTATAAAATACTGTATTTACAC
TTTGCAGACATCTCCGTAAACTATTTAGTCATACACAATT
GTAGAATTTTATAAACCCGTGAAAACACACTTTATTGCTG
GGCGAGGAAACGCGTTGGGGCGTTTAGAGCAAAGGTCTGT
TGTGCTGTTCATACAGTAGTTCATTATTATTATCAGAGTG
AAATATGCCCTTGTTCCGGCAACTTGAGCCCACCCCAGAG
AGGAAATCTCAGCGGAAGAAAAAACACTGGACTGAGGATG
AGGAGAAACCTTCCACTCTGATTGGCCTTTGTCTTCAAAG
CCTGGCCGAGAACATGAAGGAGCTGTGGGCGAAAGATTAT
GCCCAGAAATACATGGACCAGTATTTCTTCAGATACATCA
TGGGTCCCTTCAGCTTATTACCTGGTGAACTGTTAGAGGA
GCTCTTGTGTATCCTGTCCTCAAGGAATTTGTTGACACGA
GCAGCCCTGCACCTTCTTCTCCTCCCACAGCTAAGCAGTC
TGTCCCTCGCATCAGCCTGCAGCCTTGTCAATGCCAGCCT
CTGCTCTCTTATCCAGATACGCTGCCAGAATCTTCAGTCT
CTGGATCTTAGTGGTTCACAGAACATTTCTGCATCTGTGC
TGTGTGAGCTCCTGGGCAGTCAACATCGCCTCCGTTCCCT
CTCCCTGGCTGGAACCCTCTGTGATCAGAAAGTGATGTCC
GTGCTTTCCCTCCAGTGCCCCAAACTGAAACACCTGGATG
TGTCACGGTGTCTGCACCTCACCCCTGCAGGCCTGCTCCC
TCTGGCCTACCGAGAAGCCCATGTCAACAGCACAAACACC
ATCAGCAGTCTGCTTGCTCTGGATATCGGTTTAGCAGAGA
ACGAGGGAGATGCCGTATCTGCAGTCGCGTTTCTTCTGCT
TAGCTTGCCTGGTCTTCAGAGGCTGGCAGTGGAGGGACTG
GGACAGGCTTGTGTTCTCATATTAAATAGGGAGTTTGAGG
GGACTGAGGAGTTCACTAGTCGAGAAGGAGTGCAATGTCT
TAAAGACTTGTGGGCAAAGAAGACACTGGATGGCAGGAGT
TCAATGAGTGCTAACGGAGAAGAGAGGTTTACCTTGGAAG
GAAAACTAGATGAATGTTTATCGTTAGACGAGAGTGAATC
TAGGGTAAATGAATGGACAGGGACTTCAAAAGAGTGTGAT
GAAAAAGTTAGGAGTCACATTGTAAGTGATAATGTGACAA
CATGTCTTAAGGATGTTCAAGGACTGTCTTTAGACACTTT
GGAGGCTGTAGGGAAGGTCTGCCCGGAGCTGCGTGTCTTG
TCTTTGGATTGTCTCCAGAATATTGTTAATGCTGACAGCT
TCGAACATGGAGCCGTTTTAGCCAGAGGACTTGGAAGATT
TTCTGGACAGTTGAACAGCCTTTCTCTACAGTTTGCTGGT
TTTCTGTCTGATTTGGTTCCAGCGCTTCAAGCAGCAGGTT
CAAATTTGCTTTCCCTTTCCTTGGAAGGCATTAAAGCAGA
CGGACACACTGCTTTTCTGGAGCTCATTCGTGCCTGTCCC
AGACTCACCTCTCTCAGCATTCATTTAGATCCACCCAACA
GTAATATGGATGAAGATGATGAGGATGAGGATGCTGAAGA
CGAAGGACGTCTTTCTAATCTACCATGCATTCCTCACCTC
CGTTCTTTGACACTACATTTTTCCCTGGATGAGCGGCAGA
TGAAGCCGCCATTGTGTTGGACGTCTTTAAAGGATGTTCT
ATGGGCTCTACTTAGGGGTGCATCACTCCTACAGAAGCTC
TCTTTAATCGCTGTTCCCTGTCGACTGGACCCTGTGTTCA
AACTGGTCCTGAATCATCCGGCCAAACCCCTCGACGCTCT
GGACAATCCCCCACTGCAGTGCCTGAGATCTGCTAGCTTG
AACCGCTCAGATATCACTATGGACACTGTAGTACATGTTG
TAAACACTTGCAGGCGCTTATCCTGTTTGGATTTGAGCGG
CTGCTGGGAAATGAGTTTGAGCAATATTACAAAGTTACAA
AGCAAGACCAAAAGGAGGCGCCATACGCTGCAGATAACAT
GGACATGAGACGCAGGAGGAAAAGGCCCTGATGAGACTGA
AAAAGTGAGATTTTGATTCTATTTTAGATTTTTCTATATT
GTATAAAATGTGTTAATCTCTACGCTAAGCATTTCCAGTC
ATGTGTTAAATGTGCATAATAAACATTATTGATTTAGGAA
AACACATAGCCACAGTTAATGATGTGTTTACTACAGTCTG
CACTGGCCATGTTTTAACCAAAGGTAAATGTTATGCTAAT
GTTGCAATATTAAACGTATCTTAGTGTTTCTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations