Transcript

cyp1d1-201

ID
ZDB-TSCRIPT-090929-5159
Name
cyp1d1-201
Previous Names
  • cyp1d1-001
  • zgc:92205-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021489 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021489|OTTDARG00000017825|ZDB-GENE-041114-179 cyp1d1|OTTDARP00000018091 DKEY-229D2.3-001 LG_ BX296526.5 Danio rerio protein_coding KNOWN, 2326 bp
TGGAGAATTCACGCACGCGATGATCTCGCCGTCCAGTTTT
CTTCCTCTGTTAGTCTGTTTTTGGAGCTAGACCACTGGAT
GCGTCCTCTCGCTCTGCCCTTCTTCAGCTGGAATCTTTCA
CCCTGTGTGCAAGAAGTTGATTGAAAACGCGATTTGCCAA
CACTGATATAAAAGTCTATGCAATGAATCTTGAGAATATC
TCCCACACGGCTACATCTGAAGTGACTCTGATTCTGTGTG
CCTTTGCACTGCTCTTACTGGCTCTTCATGGTCGACGAAG
AGCACCAGGTGTCCCCGTTCCCCCAGGTCCCAGACCGTGG
CCCATCGTGGGCAACTTTCTCCAGATGGAGGAACAGGTAC
ATTTGTCATTAACAAACCTGAGGGTTCAGTATGGAGACGT
GTTCCAGGTGAAAATGGGTTCTCTTGTGGTCGTCGTCTTG
AGTGGCTATACCACAATCAAGGAGGCTCTGGTACGACAAG
GAGATGCGTTTGCTGGACGCCCTGACCTCTATACCTTCTC
TGCAGTTGCTAATGGCACCAGTATGACATTTAGCGAGAAG
TATGGGGAAGCTTGGGTACTTCACAAAAAGATCTGCAAAA
ACGCCCTGAGGACCTTCTCCCAAACCGAACCTAAAGACTC
GAATGCCTCTTGTCTTCTCGAGGAGCGTATCTGTGTAGAG
GCCATTGACATGGTGGAGACTCTGAAGGCACAAGGAGAGG
AGTTTGGAGACTCTGGGATTGATCCGGTTCAATTGCTTGT
GACCTCAGTTGCCAATGTGGTTTGCACTCTTTGCTTTGGG
AAGCGGTATTCCCATAATGATAAAGAGTTCCTCACCATCG
TCCATATCAATAATGAAGTGCTGCGCCTCTTTGCTGCAGG
AAATCTGGCAGACTTTTTCCCCATCTTCCGTTACCTGCCC
AGTCCGTCTCTGCGGAAGATGGTCGAGTTTATTAACAGAA
TGAACAACTTCATGGAGCGCAACATCATGGAACATCTCGT
CAACTTCGACACGAACTGTATCCGAGACATCACTGATGCC
CTTATAGCAATGTGTGAGGACAGACAGGAGGACAAGGAAT
CAGCTGTGCTCAGCAACTCCCAGATCGTTCACAGTGTCAT
TGACATCTTCGGAGCTGGTTTTGACACCATCATCACTGGT
TTGCAGTGGAGTCTATTATACCTGATCAAGTTTCCAAACA
TCCAGGATAAAATCGTCCAAGAGATAGATAACCAAGTTGG
AATGGACAGGTTACCACAATTTAAAGACAGGCCAAACATG
CCTTATACAGAAGCTTTCATAAATGAGGTGTTTCGCCATG
CGTCCTACATGCCATTCACCATACCTCACTGCACAACTGA
AAACATTACACTGAACGGCTACTTTATCCCCAAAGACACA
TGTGTGTTCATCAACCAATATCAAGTTAATCATGACATTG
AAATATGGGATGATCCTGAGTCCTTTCGACCTGAACGGTT
CCTCACCCTCTCTGGCCATTTAAATAAAAGCTTGACTGAG
AAGGTCATGATATTTGGCATGGGAATACGCCGCTGTCTCG
GAGACAACATTGCCCGTCTGGAGATGTTTGTGTTTTTAAC
CACCCTCCTGCACCGTCTGCACATAGAGAACGTTCCGGGT
CAGGAGCTTGACCTGAGCTCTACATTTGGCCTCACCATGA
AGCCCAGACCGTACAGAATAAAAATCATACCTCGTAACTA
AAACCATCATTCTCTCAGTGTTCCAGATGTTACATTATAT
GGACAAATGGACATACAGAATAATTGCTAAAGTCACAGCA
TCAAGCTAATGTTGGCATCACTGGACTGCTAAGCTAAGCT
AATCCCTTTTCTCTTCTCTACCTCTGGTTTACCTGTGTTA
TGGTTAATTTGGCACACCATGTACTTGAATATTTGCTATT
TAATATAACTGAGTAATCTGCGCATGTCCATGCAGTATTT
CTGTTAATGCATGAAGACTTAAGCATAAAACATTTGGTTA
CTTTATAGCTTAATTTTAGCACACATGTTGAATTGTAAAT
AAAAGCTGCAAGTTCTGAATTTCAGTGGCATTGAAGGTTA
GGATGATTTCTATATGTTGAAAGCCTGTTTTGTGTTAGGA
TAAATCAGAATTAAGGCCATTGATGAATTTGCTTTAATCA
ACAAATATCTTCAATTCTTAAAATGCACGCCAGTTTAATA
TATATTGGCTGTCTAATATATACAACTGATTAATTATAGA
TTAATCATATTAATACGCTATGTTAACCATGTTTTGTAAC
TCCACAGAATGTAATAGAATAAAGAACAGTTTAAATGACA
AAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations