ZFIN ID: ZDB-TSCRIPT-090929-5097
Transcript Name: zfr2-201
Previous Names: zfr2-001, si:ch211-63j24.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021414 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021414|OTTDARG00000017769|ZDB-GENE-070705-184 zfr2|OTTDARP00000018033 CH211-63J24.3-001 LG_ CR936300.18 Danio rerio protein_coding NOVEL, 4372 bp
TGCTGCTGCTGAAGTTTCTATGATGGCGGCCAGTAATTAT
TATGGATTCACACATGCAGCTGCAGCTGCCGCCGGCCCGC
AGTACAGCACTCAGCCGCCTCCTGCCTATTCCCACCCAAC
CACGGGCAGCTATAATGTCCAGCCTGCACCCGGAGTGGCT
CATGCTGTGACGGCATCATACCCTGCACCCACTGCCCAGC
CGGCACGTCCTGCAGTAACAGCACCATACCCCACCTACCA
GCCCCATCCGGCCCCAAATTATGGCTACCGCCAGCCTGAG
ACGACCCCGCAGCCCACCACCACTCCTCAAACATACCAGG
TGTTGACTGAACCGGAGAATTATACATATGGGCGACCACC
GCCTGTCAGCAGTTATGAGAACAAGCAGTACTTTCAAACC
AGCATCGCACCAGCGCAACGACCTGCGACAGAGGCCTACT
TCCAGACAGGTCTAAAAAGTGGCTACAGCCCGGCAAGCAC
AGCGTACAACCAGCCGCCGGTTCAAAGACAGGTGGCAGCC
CTGAAACCTCCGCCCGCTGTGAGCTCCGTATCTTCCAGCT
ACACCATCTACCCCACATCCACCAGCGTTCAGCAAAGCCC
AGCGCCCAGCTCCTCTTTCAACTCCACAGCTGCTACATCT
TACTCCGCTGGTCTCAACTATTCCAGCTATGACTCTAGCG
GTTACACATCTACACCTTCGTACTATCAGCCGGCTCAGTG
TGCTCCGCCGCAGGCCCAGCCCCAGCCGCCTCTGCAGCCG
CCGCAGCAACAGCCACAACCACAACCGCCACCGCCGCAGC
AAACCCAGCAGCCGCCCAAACAGCTCGCCAATTCCTCCTG
GAGCAACAGCGGTGGCAGCAGCGTCTCCAGTCCTGCTGTC
AGCTCATACAGGAAGCCGGCTTTCCACCAGAACAAGATAC
AGAAGCCTAAAGGTCCACCGAAGCAACCGCAGCTGCACTA
CTGCGATATCTGCAAGATCAGCTGCGCCGGTCCACAGACT
TATCGGGAACATCTGGAAGGGCAGAAGCACAAGAAGAAAG
AGGCGGCTCAGAAGAGCGGCAGTCAGGTGACCAATGGCCC
CCGTGGCGTCCAGACACAGTTGCGCTGTGAACTGTGCGAC
GTCTCGTGCACCGGCGCCGACGCTTACGCTGCGCACATTC
GCGGATCCAAACACCAAAAGGTGGTGAAGCTGCACACCAA
GCTTGGCAAACCCATCCCTTCCACGGAGCCGGTTTTAGTG
AGCTCCACTCCTGCTGCAATGACGACAACCACTAGTAAAC
CAGCGGCGTCGACTTCTTCCACTCCTACATCAGCAGCGCA
GAAGATCCAGACAGCGGCTCCACCCAAACCTGCGGCAGCA
CCTGTCAAAAAACCACCGCCTGCTGTTTCTGCTGCTAAAG
CTCCTGCTGTTGTCAGTAAACCGTCCACATCGACTGTGGT
GAAAATGGAGGAGGTGAAGCCGCCTGTGGTCAAAACAGAC
CCTTCCAGCGATGATGAGGATGCAGACGCTACAGGACCTC
AAGGAGACATCCAGCCTGTGGGACACGATTATGTCGAAGA
GGTTCGTAATGATGATGGAAAGGTGATTCGCTTTCATTGT
AAACTGTGTGAATGCAGCTTCAACGATCCCAACGCTAAAG
ACATGCATCTGAAGGGACGCAGACACAGACTGCAATACAA
AAAAAAAGTGAACCCAGACCTCCCTGTGGAGATCAAGCCG
AGCAATCGTGCACGGAAACTTCTGGAGGTCAAGCTGCGCA
AACAGAAGCAGAAATCTGTGCTGAAGAGACAGCAGGAGGA
CGAGCAGCGCTGGCACATGGAGATGAGCAGGAGGTACGAG
GAGGACATGTACTGGAGGAGGATGGAGGAGGAGCAAGTAT
ACTGGGCAGAGCCAAGGCGCAGGATGGCCCCGCCTCCTCT
CATGGGCCGGCCCAGCATCCCAGTGCCCCCTCTATTGCCC
GTGCGAAGGCCTGATTCACCCGATGACCGGCACATCATGG
CCAAACACTCCGCCATCTACCCTGTGGAGGAGGAGCTGCA
GGCGGTGCAGCGGATCGTCTCTCATTCTGAGCGCGCTCTC
AAGCTGGTCTCTGATACACTGCTGGAGAAAGTGGCGTGTG
CTGATGACGACGAAAGCGAGACTGACAAACAGTCGGAGAC
TCAGTCTCGTACTCTTAAAGGAGTGATGCGGGTGGGAATC
CTGGCTAAAGGCTTGCTCCTGCGCGGAGACCGTAACGTTC
AGCTAATCCTGCTAGCAGCTAACAAACCCACCGTTTCTCT
TCTGAAGACTGTAGCGGAGCAACTGCCCAAACAGCTAGCT
ACCTTTTCTGAAGATCAGTATGAGGTGCAGGTACACCCTG
AGGAAGCCAACATCGTCATTTTTTCAAGCAAGGAACCAAA
AATGCAGGTCACCATCTCTCTTACCTCACCAGTGATGCGC
GAAGACCCCGTCCCGAACATGGAGAAAGTGTCAGAGAAAG
ACCCTCCGGATCTTCTGAACAGGATCAAGTGCCTTGAGTA
TTTAGCGGCTCTGCGACATGCTAAATGGTTTCAGGCTCGG
GCCAATGGACTTCAGTCTTGCGTCATCATTATTCGGGTTC
TGCGGGATCTCTGCCAGCGCATACCAACATGGGGAAAGAT
GCCAAACTGGGCCATGGAGCTGATTGTGGAGAAGGCCATT
AGCAGTGCGTCTGGACCGCTCAGTCCTGGAGAAGCTTTGC
GGAGGGTCCTTGAATGCATCGCCACTGGCATTCTCCTGCC
AGATGGTCCTGGTCTTCTCGACCCATGTGAGAAAGGTCAG
ACAGATGCTTTGGGAACCATGTCGAAACAGGCTCGTGAAG
ACGTAACCGCTAACGCACAGCATGCACTACGTCTGCTGGC
TTTCCGTCAGATCCATAAAGTCCTCGGCATGGGCTCATTG
CCGGTGTCCAAAGCTGCCGCTAGAAACCGCAAAAGACGAC
GTGACGGCAGCGACGTCGGTGAAGGAGAAGCAGACGGAAA
AAAGGACAAAAAAGATGATTCCAACGACCCCTGAGACGTC
TGCGTAATCTCAGCAACCTTTCAAAATGTATAAATATCCC
TCAAAAGAGGAAAGAAACAAAGCAACACCCAATGGTTCTG
TTTTTTGAAAATGACAAGTGACGGAAATAACTTGTATTCG
TTCCCCTTTTATGATGTAATACCTTTTTATTACATCTGAG
ATGAAAATACGCTCCCAAAATTGGACTTAGTTTTCAGCGA
ATCAGATGATGACGATTGAACGTCACGCTACTTTAATATA
AACCGTTATTGAAAGTCACATTAGTTCTATTAGGCACTTT
TACGTAATAAAGGCACTTAATTAAAAGCTTTAATCATCCT
GACACAGGCCAGTCTCTTATGTTTACATAAGCATTTCATT
TCAAAATATATATATATGAGGTGGGGCCCAAAAGTCTGAG
AGCAGAGATTATTTTTTTAGTTAAAAACATACGTTTTATG
ATTTAAATTAATGTGAAATGCATATTATAGAATTATATTT
CAGATTCTGCACATTTAAAACAAAGTGAAGGTGATGTTAA
ATATGTAAAACAGACTTAAAAACACATCCGAATAAAAGTC
AACGTCTCAGACTCTTGAATCCCGTCTAAATCGGTTTTAT
GTGATAATATTATTATAACGAGTTCTATAATAATATTATG
GTGATTTCATGCAAATAAATTAGTTTCTCTCTATACTGTG
TATCTTAAAATGGTTTTAAAAATGCGTAGTTCCTAGTATT
CACTAATAATAAGCTGTTAAAAGTCACGATTCAGCTTTGT
GTGGTCGTCTATTAACCCCCGACACTGGATTTCTACACGT
TTAGCGCAAAACACAGACATCTCCGCTATCATTATTTTGA
ATTGCATACTGAATAATCGATCATTTCACGGCAAGAAGCT
GGCGTTTCGACAGGGTATCGAGAAGTCGTTCTTCGGCGAA
CGACGACAACGTTAAAAAAATATATATAAAAAATAAGTCT
GTGGTTCTTCACACGTGCCTGCGGTAAAGATTTAAAGTAC
TTGAAATGTGAATGACGAGGCGAAGAAGTGCGGTTCTTCA
TATTGCAATATAATATAATGTAATACCTCTCTCTATTCTT
ACATTTTTATATAAATCTTGATGTGAGATGCGCAGAAAGT
TTGCTGTTAGTATGTTGATTCTTCATATCGCTTGGATTTG
CGTTTCCGCACACCCGTTTTTACGTACAATGCGACGGTTT
CCCGCCATTTTTAGATGTTCCTGCTGAGTGTTTGTTGACT
TTTTTTTTGTAGGACTGTGAATAATTCTAGCGTGATCCTT
CATTTGGAATATCTGTGTAGTGCTGCATAACGAAATAAAC
AGAGAAACACGG

zfr2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zfr2-201 4372
ncRNA zfr2-002 (1)    Ensembl 755
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zfr2-201 Contained in:
[BAC] CH211-63J24 (1)

Genome Resources: Vega_Trans:OTTDART00000021414 (1),  Ensembl_Trans:ENSDART00000122341 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC146641 (1) 5557 nt
GenBank:BC168503 (1) 4453 nt
GenBank:CK142949 (1) 772 nt
GenBank:CD597394 (1) 650 nt
GenBank:CD015898 (1) 547 nt
GenBank:BM071094 (1) 489 nt
GenBank:DN896274 (1) 467 nt
CITATIONS (2)