header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5090
Transcript Name: si:ch211-165e15.1-202
Previous Name: si:ch211-165e15.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021407 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021407|OTTDARG00000017765|ZDB-GENE-081028-59 si:ch211-165e15.1|OTTDARP00000018028 CH211-165E15.1-001 LG_ BX004843.10 Danio rerio protein_coding NOVEL, 930 bp
ATGATCGCTGCGGCTTTCCTGGTCTTATTGAGACCCTTAA
GTCTTCAGTGTGTGTTATTGCTGCTGCTGCTTTTAATAGG
AACTATCGCCACCGTGCTCTTTCTGTGCTGTTGGCACCGC
AAGCTCCGCAATGAGAAAATCCCTATAAAATCTGTGCTCT
CCAGGCGCTCCAGGAGTCGCGAAGCTGGTTTCCGGCCGCA
TCATTTTCGCTCTGAGGTGTGTCGTCACAGTCCTCGTCAT
GTGAGGAGAAGCGCACGTGCGCGCGTGTCCGAAGAGAAGC
CGCTGGTCGAGAGCGAGCCTGACTCGAGCGCATCCGTGAG
GAAACGCAGAGTAAAGAAGAGAGTCCAGCCGGAGTTTTAC
CACACTGTGCAGCTCACACCAACACGAAAACCAAGCTCCG
GGTCCGGTAACGCGTCTCTGCGCTGCTCTATGTCTTCATC
CGCGGATTTCTCAGATGATGAAGAGTATAGTGTGAAATCT
GGGTCGGTGTCGCCGGCACCAGGGGACACTTTACCGTGGA
ATTTACCCAGACATGAGCGCTCGAAGCGGAAGATCCAGGG
AGGATCCGTGCTGGATCCAGCCGAGAGAGCGGTGCTCAGG
ATCGCCGATGAAAGAGACCGAGTCCAGAAGAAGACTTTCA
CCAAATGGATCAATCAGCACCTCTTAAAGGTCCGAAAGCA
TGTGAATGACCTGTATGAGGATTTGCGGGATGGACATAAC
CTGATCTCCCTTCTGGAGGTGTTGTCCGGTGAGACTCTGC
CGCGGGAGAAGGGCCGCATGCGCTTCCACAGACTCCAGAA
TGTACAGATCGCACTCGACTACTTAAAAAGACGCCAGGTC
AAACTGGTGAACATCAGGAACGACGACATAACAGATGGAA
ACCCAAAGCTGACACTGGGATTAATATGGACCATAATTCT
GCACTTTCAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-165e15.1-202 Contained in:
OTHER si:ch211-165e15.1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021407 (1)
  • Ensembl_Trans:ENSDART00000169888 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CR931257 (1) 539bp
    GenBank:AL926267 (1) 538bp
    GenBank:AL925184 (1) 534bp
    CITATIONS (2)