Transcript

inpp5f-201

ID
ZDB-TSCRIPT-090929-5048
Name
inpp5f-201
Previous Names
  • inpp5f-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021356 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021356|OTTDARG00000017728|ZDB-GENE-041111-194 inpp5f|OTTDARP00000017994 DKEY-192P21.1-001 LG_none BX530079.19,BX005252.15 Danio rerio protein_coding NOVEL, 3363 bp
ATGGAGCTGTTTCAGGCTAAAGATCATTATATTCTCCAGA
GCGGAGATAACGCGCTGTGGTGCAGCAGGAAGGATGGATC
TATGGCCGTGAGACCGGCAACCGACTTGTTGCTAGCATGG
AACCCTGTCTGTCTGGGCCTTGTAGAGGGCATCATTGGAA
AAATGCAGCTTCATGTTGATCTTCCTCTGGGCCTGATTCT
GATTCGCCAGAAAGCACTGGTGGGCCAGTTGCCAGGAGAC
CACAAAGTCTACAAGATCACCAAGATAGTAGTGATTCCAC
TCTCAGAGGATGAACCACAGGATCTGGAATTAGAGCTCTG
TAAAAAGCATCATTTTGGAATAAATAAACCAGAGAGAATC
ACCCAGTCACCGGATGAAACCAAGTTCCTGATGAAGACCC
TGAGTCAGATCAAATCCAATGTTGGCGCTCCCATCAAGAA
AAAGGTCAAAGAGAATAAAGAGAAGGAGCGTCTGGAGAGG
AGGCTGCTTGATGAGCTCTATAAGATATTCATGGACTCGG
ATTCTTTTTACTATAGTCTGACCTATGACCTCACCAATAC
GGTCCAGCGACAGGGAGAGTTGGGCAAGTCAGATCAGCCC
CTGTGGAAAAGGGTGGATGATAGATTCTTCTGGAACAAGC
ACATGATCAAAGACCTTGTAGACTTGCAGGCGCCTCAGGT
GGACTTTTGGGTGATTCCTATCATCCAAGGCTTCGTGCAG
GTGGAGGAGCTGGTGGTGAACTATAATGAGAGCTCAGATG
AAGAGCGAAGCAGCCCGGAGACGCCTCTGCAGGAGCCCAC
CTGTGTGGACGACATTCACCCTCGCTTCACCGTGGCCCTC
ATCTCCAGGCGGAGCCGCCACCGTGCAGGAATGCGCTACA
AGAGGAGGGGGGTTGATACAGACGGACATGTGGCCAACTA
TGTAGAGACAGAGCAGTTAATCCACGTACACAGTCACACT
CTGTCCTTTGTGCAAACGCGAGGCTCCGTGCCTGTGTTCT
GGAGCCAGGCTGGGTACCGATACAACCCCAGACCTCGCAT
AGAGAAAGGAGAGAGGGAGACTATGCCTTACTTTGCCTCT
CATTTTGAAAAGGAGGTTGAAACTTACAAAAAACTGGTCA
TCATCAATTTAGTGGACCAAAATGGACGTGAGAAGATAAT
TGGTGATGCTTATCTCAAACAAGTGTTACTGTACAACAAT
CCCAACCTAACATATGTTTCATTCGACTTCCATGAGCACT
GTCGAGGGATGAAGTTTGAGAATGTGCAGACCCTCACTGA
TGCCATCTATGACATTATCACAGACATGAGATGGGCATGG
GTGGACCAAGCAGGAGTCATCTGCCAACAGGAAGGCATTT
TTCGGGTGAACTGCATGGACTGCTTGGACAGAACCAATGT
GGTACAGGCGGCTATCGCCCGTGTCATCATGGAGCAGCAG
CTGAAAAAGCTTGGTGTAATGCCACCCGAGCAGCCACTGC
CCCTCAAGTGCTACAGGATCTATCAGGTGATGTGGGCCAA
CAATGGAGACACCATTAGTCGTCAGTACGCTGGCACAGCT
GCCCTGAAGGGAGATTTCACACGAACAGGCGAGCGAAAGT
TAGCGGGGGTGATGAAGGATGGTGTGAATTCAGCTAACCG
TTACTATCTGAACCGCTTCAGGGACGCCTACCGACAGGCC
GTCATCGACCTCATGATGGGCCATCCCGTAACAGAAGACC
TGTACTCCATCTTCAGCAAAGAGAAGGAGCATGAGGAGAA
GGAGAAGGAGAGCCAAAGAGGAGCTCAGGAGCAGGTCAGT
CTTCTGCTGCAGACCTACATGCAACTGCTACTTCCTGATG
ATGAGAAGTTTCACGGCGGATGGGCTCTAATCGACTGTGA
CCCCAGTCTTATAGATGCTACTCACAAAGATGTCGACGTT
CTTCTGCTGCTCTCCAACTCTGCATATTATGTAGCCTATT
ACGATGAGGAGGCGGACAAAGTCAACCAGTACCAGAGACT
CAGTTTAGAAGGACTCGAAAAGATTGAAATTGGTCCAGAA
CCAACTCTATTTGGAAAGCCTAAATACTGCTGCATGCGGC
TGCACTATAAGAATGGGGAGACGAGTGGTTACTTTCATAC
ACTGAGATCTGTCACACGAAATCCAGAGGACGATGGGAAA
GACACACTCCAGTGCATTGCTGAAATGCTTCGAATTACAA
AGCAAGCTATGGGGCTTGATGTTCAGGTCGTTGAGAAGAA
ACTAGAGAGGAGACACAGCAAACCCCATGAGGATATAATG
GGAATACAAGGAAAAGCAGTGGACCAAGTCCTTGGGTCTG
GATTGGCTCAAGGCAAAAGTTTCTTTTTGAACAAGTTCTC
AACGCTAAACCAGAAAGTGAAGCAGACGAAGACCAATGTC
AACATTGGAAACTTCAAACCCTTGGGGAAACTGGGGACCT
TCTCGAAGCCTGAGGTGAAAGTGAACTTCCTTAAGCCCAA
TTTGCATATGAACCTCTGGAAATCAGACAGCAGTTTAGAG
ACCCATGATAGCAATACAGGTTCGGGAGCTCTGAAAGACC
ATGGCCCACATTCAGAAGAGATTTCTTCTGATTCCGATTC
CTACAACTCGGACGAGCAGCCATGCTCAGGCTCTAGGGAA
AACGTAGACTATGTGCTTCCTAGCTGTGGAATTGTAGCAT
CAGCACCTCGGCTTGGCAGTCGCTCGCAGTCGATTGGCAG
CGTAGAGATCGCTGTGCCTTCTGTCATCCGAGTCACAGGC
TGTGATGAGAAGACTATGGATAGCTTGTCCGTTGCCGCAG
ATCAGTCTCCTGGGGCCGCCTCTGAGGCCGAGGAAGCCAT
TTTGATTGACTTTGGGACGCCTATCGATGTTTACTGCCAC
CAATTTGTACAGGATGCCAAGACCAAACCAATTGAGGTGT
TTGAGGAAGTGGCTCCAGCACCCAAGCCACAAGGACCTCA
AGTTCCCTTAGCTCCTGATGCAAAACTAGGGTCTTCACAT
TCTCAAAATCAGCTTCCTCGCCCATCTCAGCTTGAAGTGG
AGTCAAATGTCCATGGGGCGAATCTCCTGACTGTCCAGCC
TGTGGGCTCCGCAACATCATGTGGATCACAAAAGAGTCTA
GAAGGCATCACAGGACCCTCTTCAGCGGACAGCAATGGAA
GCCGTGTTGTGTCTCCCTTTGCGAAAATCAGGAGCTCCAT
GGTACAGGTGGCTAGTTTAACCCAGGCCGGACTTACCCAA
GGCATCAACTTTGCTGTGGCGAAAGTACAGAAAAGCCCAG
AGCCAGACGCTGTCAATGAAACCCAAGAGAACGAATTGCG
AGCAATGTTTACACAGTGCCAGACCAGGATCATTCAGATA
TAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations