Transcript

sec23ip-201

ID
ZDB-TSCRIPT-090929-5047
Name
sec23ip-201
Previous Names
  • sec23ip-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021355 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021355|OTTDARG00000017727|ZDB-GENE-030131-5259 sec23ip|OTTDARP00000017993 DKEY-192P21.3-001 LG_ BX005252.15 Danio rerio protein_coding NOVEL, 3382 bp
CTCTGCCTGTTCCGACTGGAGGACAAGCTACGTGTAATAT
TTGATTGAAAATGGCTGATAGGAAAGCCAATAACACCCCC
AGTAGCAGCGCAAATCTTCTGTTTTCAGGAGCTCCGGAGT
TCAACTTCAGCCTGCCATTCATACCGGTCAGCCAGGCCAC
CGGCCCGGCCGTTTTATCCGGAGAAGATGCCAGTGAAGTT
GGAGAAGAAGACAGCTTTCTTGGTCAGACAACATCTACAG
CTCCTCAGACCTCCACGTTCAATTATTTCTCAAACACTGC
CAACAGTAGTGACCCGTTTGCTTCTATAGGGCAGCAGTCA
TGCCCACCTCCAGCTGCCAATTTTATTCCATCAACAACAG
GCCCGTTACCGGCATCCATCGCAGCTAGTCTGCCTCTAAA
CCCACCTGTATCCCACATGAACCCAGTTCAGCAGTATGGC
AGTGTTGCTAATCAAGCCCCTATGCGCACATACACACCCC
CACCTAATGCACCCACTCCTCCTCCTCCCCAGAGCTCCCA
GCAGTCCTATAACCCATATCGTCACACAGCGGTCAGTAGC
AAAGCTAATCCTTACCTCATGGCTCCTGAATTACAGCAGC
AGCCCCCCAGTCAAACACCTCAGCATCTGAACCCCTACTC
TCAGCCCACACCTACTCCATCCTTCCAGACTCCACCCACA
GCCTTCACTAAGCCACCTCCAACACAGATCCCACCGCCCC
CTCCAACAACCAGCATGGCCGGACCATTAGTCCCTGCCAA
CCCAATGATGCCATACACATATAATGTTTATGAGCCTGTA
CAGCCGCACTGGTTCTACTGCAAACAAGTGGAGTCAAAAA
TTGTCTGGCTACCCTTCAGTATTCTGGATTCTATTCGCTT
GGAAGAAACGTTCAACTCTGTTCAGCCAGATCCAGAGAGT
GTGATTGTATGTACGGATGGAGGACGCTATGATGTTCAAC
TGTACGACCGCACACGGACCTCTGTGTACTGGGAAGAGGA
CCCCACAGAGGTCCGCCGCTGTACTTGGTTCTACAAAGGA
GATACAGACAGTCGCTTTATCCCCTATTCAGAAGACTTCA
GTGAAAAGCTGGAGGCGGAATATAAGAAAGCAGTCACTAC
TAATCAGTGGCACCGCAGACTGGAGTTTCCATCTGGTGAG
ACCATCGTGATGCACAATCCAAAGGTGATTGTGCAGTTTC
AGCCATCTGCTGTTGCTGATGAATGGGGTACAACACAGGA
TGGCCAGACTCGACCTCGCGTTGTCAAGAGGGGTGTAGAC
GATGATCATGATGAAGTCCCTGATGGTGAGATGCCTCAGG
TTGATCATCTGGTTTTTATGGTGCACGGCATTGGTCCTGT
CTGTGATCTGCGGTTTAGGAGTATGGTGGAGTGCGTGGAT
GACTTCCGGAGTGTGTCCTTAAAGTTGCTCAATAGTCATT
TCAGGAAGGCCCGTGATGATCATGTCATCAGTCGTGTGGA
GTTTCTGCCTGTGCACTGGCACACAGCTCTGCATGGAGAT
GCTACTGGAGTTGACAGGAGGATAAAGAAGATTACACTGC
CTAGCACTGGTCGATTACGTCACTTCACTAATGAAACCCT
TCTAGACGTGCTTTTCTACAACAGCCCGACTTACTGCCAG
ACCATTATGGACACCGTTGCTTTTGAGATGAACCGTTTAC
ACACACTATTCATGCAAAGAAACCCAGACTTTAAAGGCAG
GGTGTCTGTAGCTGGACACAGCTTGGGCTCTTTGATACTT
TTTGATCTACTGTCCAATCAGAAGATCGGCTCCCCCATTT
CAGCTCCAATATTCAATGGAAATTCTGCACCTAATGTGAA
ACAGGTAAATTCTGCTCCTGAAGTTCAGGCTGCTGAAGTG
TCTCCTGTAGCGGCTGTTGAGGAAGAGGCAAAGGAGGAAG
AAGAAGAGGAGACTGGCAGCCTGTCGTCTGTTCTGGAGGC
GATTGGGTTATCTGAATATCTGAGCATTTTTGAAAATGAG
AAAATTGATGTTGAGTCTCTGCTGCTGTGCACAGTGGATG
ATCTAAAGGAAATGAGCATTCCTCTGGGGCCACGTAAAAA
ACTCGCCAATTTTATCAAGGAGAAGTCTGCAAAACAGGCT
GCTCGAAAGGCTTTGAAAGAGAAGTCTGTAGAAAAAGAGG
AACTGAAGCAGACCCAAGCTCCAGTTCAGACTGAGCCCAC
ACCAGATCCTGCCATCAACAAACTGCCAGTGGGAAGAACC
ATGTCTTCAATCCACGTGGATTACAACTATTTTGAAATTG
GCACAGGACAGGTGTCAGTGATCTATCATGCTCTGGACTT
TGAACCGGTGAGTTTCTTCGCTCTGGGTTCTCCCATCGGG
ATGTTTCTAACTGTTCGTGGAGTGGAGAAAATTGAAGAGT
CTTACCAGCTTCCCACCTGCAAAGGGTTCTTCAACATCTA
CCATCCTCTGGATCCAGTTGCTTATAGAATTGAACCCATG
ATCTTACCAGACATTGACCTGGAGCCGGTTTTGGTCCCTC
ATCATAAAGGGAGGAAAAGGCTTCATCTCGAATTAAAAGA
GAGTTTATCCAGGATGGGTTCTGACCTAAAGCAGGGCTTT
ATCAGCTCTCTGAAGAGCGCTTGGCAGACTCTCAATGAGT
TTGCTCGAGCTCACACCTCTTCTGTTCAACTGCACGAACA
GCTCGCCATGGTGGCCAATCAGATCAAAGCAGAGGAGGAG
ATGCAGAGAGGAGAAGAGGAGAGCAAGATGCTGGAGAGTC
CTGAGCCACAGAAGGAGGAGGAAAGCCGAATAAAAGTGGG
TCTGCTGAACGGAGGAAACCGCATCGATTACGTCCTGCAG
GAGAAACCCATCGAGAGCTTCAACGAATACCTGTTTGCAC
TCCAGAGTCATCTGTGTTACTGGGAATCTGAAGACACAGC
TCTACTTCTTCTGAAGGAAATTTATAAGTCTATGAACATC
CAGCCAGATCAGTTGCTGCATTGATGAGATCAGTCAGCGA
AACCCACTCCGTCGTCAGAATTCACATTACTTTGAACATC
AGACGAGTGGACATTTTAGTCAGTTTTCAACTCTCCAACT
GGGACTGTCCTCACTTTTATTTTCTGTTATTTAGTCTGTT
GTATTAAAACGAATACACTTGTATTATTCCATATGTCTTA
AATTAAGAAATTCTAGTCAAATAGTGGATTTACAAACCAC
CGCGACTGTTCAAAACGACATTTTTATAGCTTAAATTATA
CAGCTGCAAGTGTTCGAGTGCAATTGTGAATGGAATCAAA
AGGTATTAACAGAATCTTTATTATATAGCAGTGAGAAACA
GATAGATATTACGCTGTGAAAAGAGAAACCTTCATGAGTC
ATAATAAACTTCACTGTTAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations