Transcript

eps15l1a-202

ID
ZDB-TSCRIPT-090929-5004
Name
eps15l1a-202
Previous Names
  • eps15l1a-001
  • si:dkeyp-192m14.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021084 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021084|OTTDARG00000017465|ZDB-GENE-060503-274 eps15l1a|OTTDARP00000017759 DKEYP-192M14.7-001 LG_ BX908392.13 Danio rerio protein_coding NOVEL, 5292 bp
GTTTCCGCAGCAACAGGGAAAAGATGGCAGCCCTCGCGAC
CCTCACTCAGCTGTCAAGCGGAAACCCTGTATATGAGAAC
TTTTACAGACAGGTCGACCCAGGAAACACCGGTAGGGTTG
GACCAACAGAGGCTGCCTTGTTCTTGAAGAAATCTGGTCT
GCCTGACATCACATTAGGAAAGATCTGGGATTTAGCTGAT
CCAGATGGCAAAGGTTTCTTGGACAAACAGGGATTTTACG
TTGCTTTGCGTCTCGTGGCATGTGCACAGAGCGGCCACGA
CATCAGCATTTCCAGTTTAAATCTCCCTGTTCCTCCACCA
AAATTCAAGGATCACAGTAGTCCATCACTGAGTTCAGTAA
CATCTACTAATGAGAGTCACTGGGCTGTGCGGCCTGAAGA
GAAGAGCAAATTTGATGGTATTTTTGAAAGTCTTGCCCCG
GTGAACGGATTACTGTCTGGTGAGAAGGTCAAACCAGTAC
TGATTAACTCCAAACTACCTGTAGATGTTCTCGGAAAGGT
GTGGGATTTGAGTGACATAGACAAAGACGGACACTTGGAC
AGAGATGAGTTTGCAGTGGCAATGCATCTGGTGTACCGCG
CACTGGAGAAGGAGCCTGTGCCGTCCGTCCTGCCCTCCTC
ACTCATCCCTCCATCCAAAAGAAAGAAGTCGTCAGGGTCA
TTGTCCAGCATGGTGCCAGTGTTACCGGGAAGCCCACCGC
CACCTAAAGACAGCCTGCGCTCAACTCCCTCTCACGGCAG
CATGAACTCGCTCAACAGCGCCGGAAGTCTGTCCCCAAAA
CACACGCTCAAATCCTCACAGCATTCAGTAAACTGGGTAG
TGCCGGTTGCAGACAGGGGGCGCTATGATGACATCTTCCT
CAAAACAGACTCAGATCTGGATGGTTTCGTCAGCGGACTA
GAAGTTAAAGACATCTTCATGCAGTCTGGACTTCATCAGA
ACCTTCTGGCACACATTTGGGCTTTGGCGGACACCAGGCA
GATGGGCAAACTCACACGCGAGCAGTTCTCCTTAGCCATG
TATCTAATTCAGCAGAAAGTGAGCAAAGGTCTGGATCCTC
CGCAGGCTTTGACACCAGACATGATCCCACCATCTGAACG
CGGCACACCGGGACCTAGTCTGTCAGGATACATGACACCG
GTGGGATCTGACATGGCCGCACTGACTGAGATGCGCCGGG
ACAGCTCCAGCTCCGTGGGTTCAGGAGAATTCACCGGGAT
TAAAGAACTGGATGATATCAGCCAAGAAATCGCACAACTG
CAGAGCACTCTTGCTTTCACACACTGGGATACACTCAGAG
AGAAGTACACTTTGGAACAAGATATTAGAGAAACCGAGGA
GGCCATCAGACACAAAACCACTGAGGTTCAGGAGATGCAG
AATGATTTGGACCGAGAAACGTCGAGCCTCCAGGAGCTGG
AGGCGCAGAAGCAGGATGCCCAGGACCGGCTGGAGGAGAT
GGACCAGCAGAAGGCTAAGCTGGAGGACATGCTCAATGAT
GTTCGACAGAAGTGCCAGGAAGAGTCACAAATGATCTCTT
CTCTGCAGACTCAGATACACTCGCAGGAGTCTGACCTGCA
GAGCCAAGAGGAAGAACTGGGCCGAGCCAAAGCAGACCTG
AACCGCCTGCAGCAGGAGGAAGCTCAGCTGGAGCAGAGTC
TACAAGCCGGACGGATTCAGCTGGAGACCATCATCAAGTC
CCTCAAAGCCACACAGGACGAGATCAACCAGGCTCGAAGC
AAACTCTCCCAGATCCAGGACAGCCAGCATGAGATCAGCA
AGAACATCGAGCAGTACAGCAGCACCCTGAATGGCACCCA
TGGGGGCAGCATGACCAACCTGGCCGACATGAGCGAAGGA
TTCCCTGAGAAGGAGAATGGAGGTTTTGGAGCCATGGAAG
ACCCGTTTAAGGTAAAGCCCACTGTGTTCAACAGCGCCCC
TCAGGAGATGCACACAGACCCCTTCCAGTCTGAAGACCCC
TTTAAAACAGACCCTTTCAAAGGCGATCCGTTCCAGAATG
ACCCTTTCTCAAAACCGGCCACCACAGTCCCAGATCCTTT
CGGTGGAGACCCTTTTAAAGAAACCGACCCATTCAGGACG
TCCTCTGAAGATTTCTTCAAGAAACCCTCCAAACCGGACC
CCTTCACCAACGCTGATCCTTTTAGCAAAAGTGCCACTCT
GCCCTCAAAGAGCCATCATTTCGCAAGTAACGACCCCTTC
ATCTCAACCAGCCCCAAACCGAAAGGTCAAGATTTCTTCG
GCACTTTAGACCCATTCGGTAGTAGTACGTTTGGCAGCAA
CAGCGGCTTTGCAGACTTCAGCCAAATGTCAAAGGGCTTT
GTAGAAGACCCCTTCAGCCGAAAACAAGACATGCCAGCAC
TCCCGCCCAAAAAAAGTATACCACCACGACCCAAACCACC
CAGCGGTAAAAGCACTCCAGTAAACGTGCCCGGATCTGGC
GATCCGGCCAAGACGAGCGATCCCTTCCAGCCCTTCAGCG
CCGACCCCGTTGACCCGTTTCAGTGTAAAAAGGGTGTGGG
AGATCCGTTTAGTGGCAAAGACCCGTTTGCTCCATCTGCC
CCAAGTAAAGCCTCTAAAGACTCTTCATTGGGTTTTGCAG
ACTTCAGCTCTGTAAGTTGAGCTTAGTGATACTCTTCTCT
TGTCCGGTCCACTTGTCTCTTTCCAAAAATCAAAATAAAT
CCAACCAACAAACCAAAAAAAAGTGCTTTCTAGCGATCAT
CAGTGAGGTTTTTCTAGAGCAGACCGCACCATTGGCTTCT
GTACCGCTCAGTCTGTCGCCTTGTGCCGGCTACTCATTTA
TTTTCCTCCATGTCTGCAGTCCATCTATATGTGATTAACT
CTACAGCGCACTGAATTCTGGATAATAAGCCCTAATCAAG
CAGCCAGACATCATCTTTCTCTCTATCAGCGACTCGAATA
CAGTTGTTTGTGGCGCACATGGCTATGATGTCATCTGTCG
TTTTGCTCAGCACTTGCATGGGCTTGTGGGAAGAGGAGCA
GTCGCACTTGGTGATACCAAGAGATCTCAGCTAAGCTAAT
GTGGCTTCTCGCTGTTCTTCTGTGACGTTTTGTTGTTAGC
TTTTATGCAATTATGTCTTGTCTTCTTGAGAAACAGTATT
ATCAAAACTAAATTCTTGGTTTGAGTTTACTTCAAATCAA
GAGTGAATGTTGTATAGTTTATGTCAATATTAGTTAGGTT
GTAAAGACGTAGCATTTTACAAAAGCCTGTGACTAGCAGG
TTCAGATCATAACTTATCAGACGATATTTTCTTGTTTACT
TGCCACGTAAAGTGACCTGCAGAAAATGTCAGGGCTTTAT
CGTAGAATTAATGTGGTTTTTTTTTGTTTTTATCTGAGAG
AAACTAAAAAGTTTGCTTCGTTATGTTGGCGATTATGCTA
AAATTTGCTAATATGTCAATGTTTTTGCTTCAGCATCATC
TGCAAAGTAGACAATCTCCTTAAGAAAGCGCAAAATCTGC
AATAGTTTGCTAGCTCAGAAAGAAACGTGAAGTATAATTG
ATATGCCATAATCGATGACAGTATTCAAAGCCTTCAGACT
GGTCAAATAAGAGAATTGTAATTTCTTCCAGGTTCGCTTG
AACCAATCAGCAATGTTTATAGTGTTATTGATGTGTTTGG
TGTCAGTTTTGTGCGTAAATGAACCATCTGGATAGGTTTC
TAAGAGAAACCTTGATTACAAAGTTTGTAACAGCAGTATT
TTCGTCTCAGATATTCCTTTGTTTAAGAAGCATAAATTAA
AACAACAATCAGTATTTGCAATTAAATTAAAGGTAGTAAT
GTCAGTATTTTCTTTTCCGTATCTATTGTCAGTTTAGTTC
ATCTCATGGTCTGCAAAGATTGACTTCTGGCCATGTTATA
AAAGAAAAACACACATTTTATAATATATAAGTGTTCTGAA
ATTTAATTGGAACTAAATATTGGTTTTTAGTCAATGTTTA
TTGTCAGCATTTTCGTCTGTTTCCTGCATCCTGCAAAATT
GTAGTATATTCGGTTTGTAGTAGCAGTATTTTCAACACAA
AACTTTGAGTTTGTTCATTTGAACAATCAGTGTTTGTTTA
ACTAATGTGTCTATTGTCAGTATTTTCGCCTCATGGTCTG
CAGTTTACTTTTAAGAAACCCTGAAACTTTGTTTAATCAT
TGTGTCTGTTGTCTGATCGTTTCCTAAAATGTCGGATTTC
TTGCATCCTGAAAGTTTGTTCATCATTATTCTGTGGCATT
AGTCTCTGTGACGAACCTTAGATTCATGAACATCCCAAAC
AACCGTTCAATCCAACTAAATATCAATAAGAGTTAACACA
AATTCACAAAAGTCTTAGTTTATTTCTTTCTCTGGTTCTC
ACCATTCTCTTATCAGCCATCGGTTCATATTTCAAGAAGT
GTGGGTAGCTCATATTGACACATCTGCCTTGTGGTCACAC
TTCCACGAGTTAGTGGAGCAAACATAATCATTATCTGAAT
CTTATCGCAACCAATGTAGTTTCATGGTTCTTGTCTCTTG
TTTAATGAGGAAAATTAAAATCAAAGGACTCCTAAACCTT
TTAAAGTCGATTAGGTTTGATGGTTTGACGTGGGAAGTGG
CAGTATCACTACTCAGCTCTCAGGCTGTCGTTTTTTACTC
CGCATGGGATCAGTGTGCGCTCCATACTGCAATTCCGCTT
GATCCTAGAGCCACAGTGTTTGATGTAGCTTCATCTTCAT
CCGCTCTGCCTCCTGTCCTTAGTATCGCTGTGCACGACTT
GGGTGCGGTGGACTTGCTAAACCATCTCTGATTTATCACA
CACTCCTTGAAATTGCGACAGTTGCAACGTTTACAGAGAA
AATGCAGTTTTTAACGAATTTACCAATAGCAGTATTACAT
TGCATTTTCAAAAAAACTGTGACTTGTTTACTATTTATGT
TCAGAGATTGGTTTCTTCACAAATTAATGTGTTATGTTGA
TGCATGTGTTATGACGAAACAGTTTAAATACATTTTTACA
AATATTTCCCAAGGTGGTTTAGCAAAGCTCACATTCACCC
GTTGTCAACTTTTGGTGTGCATGTTATGTTGCATAATTTA
TGCTTATATATCTCTGTACAAGATTTGAAGCTCTCGAATT
GAGAAAAAAAAAGCTTTGTATTGTCTTTTCCTTCTGTCAT
TATCTTGCTGCACGAGATCAATGCATGCTCATTTTCCTGT
CCATGACATCATTCGCTATTAATGACCAATTAAAAAGGTC
TTTCATGAGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations