Transcript

si:dkey-117n7.5-201

ID
ZDB-TSCRIPT-090929-4991
Name
si:dkey-117n7.5-201
Previous Names
  • si:dkey-117n7.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021063 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021063|OTTDARG00000017451|ZDB-GENE-060503-331 si:dkey-117n7.5|OTTDARP00000017748 DKEY-117N7.5-001 LG_ BX004864.8 Danio rerio protein_coding NOVEL, 1017 bp
ACTACTCTCTATAGCACTCTCAGTAATACTCTAATGTAAC
ACTCTTATGACTTCTCTCAATTTAAATGATTGTTTTTCCT
TTTTATTTGAATGCATTTGAATTTAATTTGGCAAATAAAG
TTGCTCATGTTTTCAACTAAAGGAAAAGAAATCCTCCTGA
TGGTGAACACCAATGATCCAGATGATGGGAGCATCCTGAG
GGAAGAGAAAAGAGTGGATTCTGCCTCTCGCTTTTTGCTC
ACCCGTCCCAAAGTGTGGGACGAAGAGGTGGAGGATGAAA
CAACTACAGTTCATCCTGCTGTTTCCGAGCCAACAACAGC
ATATGGCAACGTTACAAGTGCCAGTGCTGAGAGAGCTGGA
GAGCAGAGAGAAAAGAGACGTGTACTCAAGCTCCACTCAG
TGAATGTCGACTCGGCAGCTGAACTCTGTCTTGAACCCAT
GTCCGAGGGCCACTGCACTGAATACGTCCTGCTCTGGTAC
TATTATGCCGTGTCAGGAGAATGCCGTCCTTTTGTGTACG
GTGGCTGTGGAGGAAATGGGAACCGATTCAGCTCCAAACA
GGACTGCCAGAGTACATGCATTCTGGGAAGGAGAGATTCT
GGATCCTGAAGAAGGAAAATACATGCTATTTTAACAGCTA
AACTGATGTTAACTTTACTGAAAATGCTATTTTTGTACAT
TTCCCATATGTATATTAGTCCATTATAGCTGTATGCGACA
AAAACAATGTTCATAACTTCCTTATTCATCATGTATTGCA
CTTTTGTTGTAATACAAGGACATCAACAAATTCATAACAC
ATGATCTTTACTTTAAGCCATACAGTTTTGTTGGTATGAT
TAAATGTGTAAATGTTGATTTACAGTTTAAAAAATGATTA
ATTTAGTTGTTAAATGCACTATTATTATAAGTGTCCTGTT
TACCATTTTGCACTAATGGTTCGGTTTGTAATATGTTCCT
AATCTGACTGTTTTTAATATAATATGTGAGATAATAAAAG
AATGAACGGAATACATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations