ZFIN ID: ZDB-TSCRIPT-090929-4967
Transcript Name: aacs-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021002 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021002|OTTDARG00000017407|ZDB-GENE-040426-903 aacs|OTTDARP00000017697 aacs-001 LG_ CR759959.15 Danio rerio protein_coding KNOWN, 2817 bp
CAACTCGCGTAGTGCGATTCTTTGAGTCTTCATAGCTTAT
TCACGATACGTTGGCGCGTGTCATCCGATCATGTCTAAAG
ACACGGAGGCCAAGAGCGAGGAGATTATGGAGTCGAAGGT
GCTCTGGTACCCGGACTCCAAGCGAAACACACAGACGGAC
CGATTCCGAACTCTGGTTAACCGGGAATTCGGCTTGAACC
TGGCAAACTATAATGACCTATACCAGTGGTCTGTGGACAG
TTATCCTGAGTTCTGGGCACAGGTTTGGAAATTCTGTGGA
ATCACCTGCTCAAAGATGTATGAGGAAGTGGTTGATGTGT
CGAAAAGGATATCAGATGTACCCGAGTGGTTTAAAGGCAG
CAGACTGAATTATGCAGAGAACCTGCTCAAACACAAAGAC
CAGGACAAAGTGGCGCTTTATGCTGCAAGTGAAGCGAAAG
AAGAGATAGTCAAGGTGACTTTCGGTGAGCTGAGACGTGA
TGTCGCTCTCTTCGCTGCCGCCATGAGGAAGATGGGCATC
AAAATTGGAGACCGGGTCGTAGGATATTTGCCCAATGGGG
TTCATGCTGTGGAGGCCATGCTCGCTGCTGCCAGTATTGG
TGCCATCTGGAGTTCAACCTCTCCAGATTTTGGTGTCAAT
GGAGTTCTAGACAGGATCTCTCAGATTCAGCCCAAGCTGA
TATTCTCAGTAGCAGCTGTTGTGTATAACGGAAAACAGCA
TGACCATATGGAGAAACTCCAGAACGTTGTTAAAGGCCTC
CCTGACCTGAAGAAGGTTGTGGTTATTCCATATGTTCGCT
CTAGACAAGAGACTGATCTCTCCAAGATTCCCAACAGTGT
TTTCCTGGAGGACTTTTTAGCCACCGGTAAAGAAGGGGAT
CAGGACCCTCAGCTGGAGTTTGAGCAGCTGCCCTTTTCTC
ATCCTCTCTTCATCATGTACTCCTCTGGAACCACAGGAGC
TCCCAAATGCATGGTTCATTCTGCTGGGGGCACTCTCATC
CAGCATCTTAAAGAACATATTCTCCATGGCAACATGACCT
TCAATGATGTCATCATATATTACACTACAACGGGCTGGAT
GATGTGGAACTGGCTGATTTCCTCTCTTGCTGTTGGAGCT
TCTGTGGTCTTGTACGATGGCTCTCCTCTTGTTCCCAGTG
CCAATGTGCTGTGGGACCTTGTGGACCGTCTTGGAATCAC
AATTTTTGGGACTGGAGCGAAATGGCTGGCTGTGTTGGAA
GAGAGAGATCAAAAACCAGCAAGCACACACAGCCTGCAGA
CCCTCCACACACTCCTGTCTACAGGATCCCCACTGAAGCC
CCAGAGCTATGAATATGTGTACAGCTGTATTAAGAACAAC
GTGCTCCTGGGATCTATATCAGGTGGCACAGACATCATTT
CATGCTTCATGGGTCAGAACATGACGGTGCCTGTTTACAG
AGGAGAAATTCAGGCCCGAAATCTGGGCATGGCCGTCGAG
TCCTGGAGCTGTGAAGGTAAGCCTGTGTGGGGTGAAAGCG
GTGAGCTGGTGTGTTTGAAGCCCATCCCGTGCCAGCCCAC
TCATTTCTGGAATGACGAAAACGGCAGCAAATACCACAAA
GCCTACTTTTCCACCTTCCCAGGAGTCTGGGCCCACGGTG
ATTACTGTAAAATCAACCCAAAAACAGGAGGAGTCGTCAT
GCTGGGGAGAAGTGATGGAACCTTGAATCCTAATGGTGTT
CGGTTTGGGAGCTCTGAAATTTATAATATAGTTGAAGCCT
TTGACGAAGTGTCCGACAGCCTTTGTGTCCCTCAGTACAA
CAGTGACGGAGAAGAGAGGGTGATTCTGTTTTTGAAAATG
GGACCCAATAAGAGCTTTAGCCAGGAGCTAGTAGGAAAGA
TCCGTGGTGCTATTAGAGTAGCTCTCTCTGCACGACACGT
ACCAGCCTTGATACTGGAGACCAAAGACATCCCGTACACT
ATCAGCGGAAAGAAGGTGGAAGTTGCAGTAAAGCAGGTGA
TTGCAGGTAAGGAAGTCACTCAGCGAGGGGCCTTCTCAAA
CCCAGACTCTTTGGACCTTTACAAGAACCTACCTGAACTC
CAGAACTTCTGAGGTACTCATGCAGATTCCGTTCAAAGGA
ACGTCTATTGGACCATTTGGAGGGAATTAAACATTGAAGC
TTTTTCTGCACATTGTGGCACTTACGCAAACTTCACTGGA
GCCAATGGAGTTTGAACACGCAACACCTTCCCAGAAGTGT
TCCTCTTGGGTAGAAAGTTGAGAATGGCATTTTAGGAGAT
TGCAGTCGGGATTTCAAAGGGACGTTTTATCTGCTTTCTG
TTATTGTGTTATTCCCCAGAGATGTACATCACAAGAAATT
CCCAAATCTGATTTCCTAAAGGGTTAGTTCACCCCAAAAT
GAAAGTTTGGTTATTAATTACTCAATGTCATGTTGTTTCA
ATCACTTGAGATGTTTGTTCACCTTCTGAAGAAATTATAG
ATGAAATCCAAGAGCTCTCAGACACTCTATAGCAGTGTTT
CTCAACCATGTACCTAGAGGACCACTAGCTCTGCACATTT
TCCAGGTCTCCTTAACCAAACACACCTGATTCAGATCATC
AGCTCATTAGCAGAGACTGAAAAGCCTGAAATGGGTTTGA
CAGACAAAGGAGACATCCAAAACATGCAGTGCTGGTGGTC
CCCCAGAAATGTGGTTGAGAAACACTGCTATTTAGACAGA
AATACAGACCAAAACATTATCAAAACCTTCCATCTAACGT
CAATGATTCAACTGTGACACGAAGCTGCAAGAACATTTTC
GTGCACCCAAAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aacs-001 Contained in:
OTHER aacs-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021002 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC050501 (1) 2786bp
    GenBank:CK686414 (1) 685bp
    GenBank:BM103155 (1) 615bp
    GenBank:BM103999 (1) 549bp
    GenBank:BG799258 (1) 525bp
    GenBank:CK675889 (1) 203bp
    CITATIONS (1)