Transcript

aacs-201

ID
ZDB-TSCRIPT-090929-4967
Name
aacs-201
Previous Names
  • aacs-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021002 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021002|OTTDARG00000017407|ZDB-GENE-040426-903 aacs|OTTDARP00000017697 aacs-001 LG_ CR759959.15 Danio rerio protein_coding KNOWN, 2817 bp
CAACTCGCGTAGTGCGATTCTTTGAGTCTTCATAGCTTAT
TCACGATACGTTGGCGCGTGTCATCCGATCATGTCTAAAG
ACACGGAGGCCAAGAGCGAGGAGATTATGGAGTCGAAGGT
GCTCTGGTACCCGGACTCCAAGCGAAACACACAGACGGAC
CGATTCCGAACTCTGGTTAACCGGGAATTCGGCTTGAACC
TGGCAAACTATAATGACCTATACCAGTGGTCTGTGGACAG
TTATCCTGAGTTCTGGGCACAGGTTTGGAAATTCTGTGGA
ATCACCTGCTCAAAGATGTATGAGGAAGTGGTTGATGTGT
CGAAAAGGATATCAGATGTACCCGAGTGGTTTAAAGGCAG
CAGACTGAATTATGCAGAGAACCTGCTCAAACACAAAGAC
CAGGACAAAGTGGCGCTTTATGCTGCAAGTGAAGCGAAAG
AAGAGATAGTCAAGGTGACTTTCGGTGAGCTGAGACGTGA
TGTCGCTCTCTTCGCTGCCGCCATGAGGAAGATGGGCATC
AAAATTGGAGACCGGGTCGTAGGATATTTGCCCAATGGGG
TTCATGCTGTGGAGGCCATGCTCGCTGCTGCCAGTATTGG
TGCCATCTGGAGTTCAACCTCTCCAGATTTTGGTGTCAAT
GGAGTTCTAGACAGGATCTCTCAGATTCAGCCCAAGCTGA
TATTCTCAGTAGCAGCTGTTGTGTATAACGGAAAACAGCA
TGACCATATGGAGAAACTCCAGAACGTTGTTAAAGGCCTC
CCTGACCTGAAGAAGGTTGTGGTTATTCCATATGTTCGCT
CTAGACAAGAGACTGATCTCTCCAAGATTCCCAACAGTGT
TTTCCTGGAGGACTTTTTAGCCACCGGTAAAGAAGGGGAT
CAGGACCCTCAGCTGGAGTTTGAGCAGCTGCCCTTTTCTC
ATCCTCTCTTCATCATGTACTCCTCTGGAACCACAGGAGC
TCCCAAATGCATGGTTCATTCTGCTGGGGGCACTCTCATC
CAGCATCTTAAAGAACATATTCTCCATGGCAACATGACCT
TCAATGATGTCATCATATATTACACTACAACGGGCTGGAT
GATGTGGAACTGGCTGATTTCCTCTCTTGCTGTTGGAGCT
TCTGTGGTCTTGTACGATGGCTCTCCTCTTGTTCCCAGTG
CCAATGTGCTGTGGGACCTTGTGGACCGTCTTGGAATCAC
AATTTTTGGGACTGGAGCGAAATGGCTGGCTGTGTTGGAA
GAGAGAGATCAAAAACCAGCAAGCACACACAGCCTGCAGA
CCCTCCACACACTCCTGTCTACAGGATCCCCACTGAAGCC
CCAGAGCTATGAATATGTGTACAGCTGTATTAAGAACAAC
GTGCTCCTGGGATCTATATCAGGTGGCACAGACATCATTT
CATGCTTCATGGGTCAGAACATGACGGTGCCTGTTTACAG
AGGAGAAATTCAGGCCCGAAATCTGGGCATGGCCGTCGAG
TCCTGGAGCTGTGAAGGTAAGCCTGTGTGGGGTGAAAGCG
GTGAGCTGGTGTGTTTGAAGCCCATCCCGTGCCAGCCCAC
TCATTTCTGGAATGACGAAAACGGCAGCAAATACCACAAA
GCCTACTTTTCCACCTTCCCAGGAGTCTGGGCCCACGGTG
ATTACTGTAAAATCAACCCAAAAACAGGAGGAGTCGTCAT
GCTGGGGAGAAGTGATGGAACCTTGAATCCTAATGGTGTT
CGGTTTGGGAGCTCTGAAATTTATAATATAGTTGAAGCCT
TTGACGAAGTGTCCGACAGCCTTTGTGTCCCTCAGTACAA
CAGTGACGGAGAAGAGAGGGTGATTCTGTTTTTGAAAATG
GGACCCAATAAGAGCTTTAGCCAGGAGCTAGTAGGAAAGA
TCCGTGGTGCTATTAGAGTAGCTCTCTCTGCACGACACGT
ACCAGCCTTGATACTGGAGACCAAAGACATCCCGTACACT
ATCAGCGGAAAGAAGGTGGAAGTTGCAGTAAAGCAGGTGA
TTGCAGGTAAGGAAGTCACTCAGCGAGGGGCCTTCTCAAA
CCCAGACTCTTTGGACCTTTACAAGAACCTACCTGAACTC
CAGAACTTCTGAGGTACTCATGCAGATTCCGTTCAAAGGA
ACGTCTATTGGACCATTTGGAGGGAATTAAACATTGAAGC
TTTTTCTGCACATTGTGGCACTTACGCAAACTTCACTGGA
GCCAATGGAGTTTGAACACGCAACACCTTCCCAGAAGTGT
TCCTCTTGGGTAGAAAGTTGAGAATGGCATTTTAGGAGAT
TGCAGTCGGGATTTCAAAGGGACGTTTTATCTGCTTTCTG
TTATTGTGTTATTCCCCAGAGATGTACATCACAAGAAATT
CCCAAATCTGATTTCCTAAAGGGTTAGTTCACCCCAAAAT
GAAAGTTTGGTTATTAATTACTCAATGTCATGTTGTTTCA
ATCACTTGAGATGTTTGTTCACCTTCTGAAGAAATTATAG
ATGAAATCCAAGAGCTCTCAGACACTCTATAGCAGTGTTT
CTCAACCATGTACCTAGAGGACCACTAGCTCTGCACATTT
TCCAGGTCTCCTTAACCAAACACACCTGATTCAGATCATC
AGCTCATTAGCAGAGACTGAAAAGCCTGAAATGGGTTTGA
CAGACAAAGGAGACATCCAAAACATGCAGTGCTGGTGGTC
CCCCAGAAATGTGGTTGAGAAACACTGCTATTTAGACAGA
AATACAGACCAAAACATTATCAAAACCTTCCATCTAACGT
CAATGATTCAACTGTGACACGAAGCTGCAAGAACATTTTC
GTGCACCCAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations