header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4956
Transcript Name: ydjc-201
Previous Names: ydjc-001, si:ch211-89f7.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020972 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020972|OTTDARG00000017379|ZDB-GENE-060526-182 ydjc|OTTDARP00000017671 CH211-89F7.6-001 LG_ BX957246.7 Danio rerio protein_coding NOVEL, 942 bp
ATGCCTCAACCCAAAGTGAAGCTGGTGGTGACAGGAGATG
ATTTTGGGTACTGCGAGAGGAGAAATCAAGGGATTGTGGA
TTGCTTCAGAGCTGGTGGCATTTCCAATGTCTCTCTCCTG
GTGAATGCAGTGTCAGCGAAACACGCGGCAGACCTGGCTA
AAAGGTACCACATGCCCATTGGACTCCATGCGAATCTCTC
CGAAGGTCTTCCAGTGTCTCAGGAACTGAAGGGTTCAACA
CTCCTCAACAAGGATGGTTTCTTTCATGGCAAGATGGGCT
TCAGGGAAGTTTTGCACAGTGGTCAGCTCAAGATGTCAGA
GGTGGAGGCGGAGCTTAGAGCCCAGGTGAATCGCTTCTTT
GAACTGATTGGCCACATGCCTTACCATATGGATGGACACC
AGCATGTGCACGTGTTGCCAGATGTGCGAGAGGTCTTTGC
ACAAGTTCTCTCTGATTTTGGGATCACCTACACCCGGGTC
CCTATAGAGCCCGGTCTAAGGTTTTGCAACTTCCTCCCAT
CCCATCTGAGAGAATTCAACGCGCAGGTGGAAAAAGATGC
CCTTGAATCTGTTGAGGTTTTTCATCGGAATGGAATCAGA
TGGCCTGACGTGTACCTGGGCCTGAGCACCATGGGTAAGA
ACATGTGTTTGTCCAACCTAAAACGTGCTTTGGAAGCTTC
ACTGGACGACGGTGTATCTTCTCCATTGATTCTGACACAG
TCCAACAATGCAGCGAGCAACTGCTACCGACCGGTTACGG
CAGAGCTCATGGTGCATCCAGGATATCCCAGTCAACCTCA
GCAGGGTGGATGTGGAGAAGGACCGGACGACTTTTCACAG
TCCACAGATCGACTACATGAGCTGAACACATTAAGAGACC
CAATGGTGCTCAACTTTTACAGGCAACAAGGGATCCATCT
GTGTGCTTTCAAAGACTTTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ydjc-201 Contained in:
[BAC] CH211-89F7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000020972 (1),  Ensembl_Trans:ENSDART00000090851 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)