Transcript

si:dkey-28d5.8-201

ID
ZDB-TSCRIPT-090929-4938
Name
si:dkey-28d5.8-201
Previous Names
  • si:dkey-28d5.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020903 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020903|OTTDARG00000017320|ZDB-GENE-060503-354 si:dkey-28d5.8|OTTDARP00000017610 DKEY-28D5.8-001 LG_ CR318599.18 Danio rerio protein_coding NOVEL, 1148 bp
AGACAGAAACATCAGATCGAGGACAGAAACACACCAGCTC
TGAGAAATGGCTCAATCTCTATATTTCCCTCTTCTACTCA
TTGCTCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTA
TCACTTTATAAATGTGAACAAGAACTGGACTGAAGCTCAG
AGATACTGCAGAAAGAAATACACAGATCTGGCCACTGTTG
ACAACATGAATGACATGATCCAGCTGATGAAGAGTGTGAA
TGATGGAGTTAATCAGTTAGTCTGGATTGGTCTTCAGAAG
GCAAATGTTTATAAATGGCATTGGTCTTCAGGTGATCCTG
TGCTCTTTCTGAACTGGACATCTGGAGAATCAGCTGGCAG
TAATCAGTGTACTGTTATGTGTAATGGACAATGGATTAAA
GAGGCATGTAATAACACTAGTGTCTTCATCTGCTACAACA
TGAGCAGAGGACTGGTGTTTGTCAATCAGACGATGAACTG
GAGAGACGCTCAGAGTTACTGCAGACAGAATCACATTGAT
CTGGTCAGTGTGAGGAACCAAAATGAGAATCAACAGCTGG
AGAAGTTCATTAATGACAGAAACTCATCTGGATCTGCAGT
CTGGATCGGTCTGTTCAGTGACACATGGCAGTGGTCAGAT
CAGAGCAACTCCTCATTCAGATACTGGGCAGATAATTTTA
AAGATTTTTCATACAGTGCCGCTATTCAACCAAACAAATC
AGGACAATGGGGTGACTATTCTAGTGATTACAACCAGTTT
CCTTTTGTGTGTCATGAAGATAAACTGATTGTGGTCCAAC
AGGATCTGTCGTGGTCTGAAGCTCTGAGATACTGCAGACA
GAATCATGTGGATCTGGTCTCGGTTCAGTCAGAGGAGATG
CAGTATAAGGTGATGAACGTGGTTAAACTGGCGTCTACTG
AGGCGGTGTGGTTGGGTTTGCGTCACTCCTGTGCTTTGGG
CATCTGGTTCTGGGTGAGTGGAGAGACCGTGTGCTATCAG
AACTGGGCTCCAGGGAACGGCACATCAGAGGAGGACTGTG
AGCCCACAGTGAGATCTGGAGCAGTTCAGTCTGGTGGAAA
TCGGACCTGGATCAGCCGTCCTGAAACTGATAAACTCAAC
TTCATCTGCAGAAACTACTGAGAGTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations