ZFIN ID: ZDB-TSCRIPT-090929-4934
Transcript Name: si:dkey-28d5.10-201
Previous Name: si:dkey-28d5.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020899 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020899|OTTDARG00000017318|ZDB-GENE-060503-353 si:dkey-28d5.10|OTTDARP00000017606 DKEY-28D5.10-001 LG_ CR318599.18 Danio rerio protein_coding NOVEL, 1143 bp
GAATCATCAGACTGAGGACAGAAACACACCAGCTCTGAGA
AATGGCTCAGACTCTATATTTCCCTCTTCTCCTCATTGCT
CTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTATCACT
TCATAAATGAGAAGAAGACCTGGACTGAAGCTCAGAGATA
CTGCAGAGAGAAATACACAGATCTGGCCACTGTTGACAAC
ATGAATGACATGATCCAGCTGATGAAGAGTGTGAATTATG
GAGTTAATCAGTTAGTCTGGATTGGTCTTCAGAAGACAGA
TGTTTATAAATGGCATTGGTCTTCAGGTGATCCTGTGTTC
TTTCTGAACTGGACATCTGGAGATCCAGCTGGCAGTAATG
AGTGTACTGTTATGAATAATGGACAATGGATTAATGAGGC
ATGTAGTAACACTCGTGTCTTCATCTGCTACAACATGAGC
ACACGACTGGTGTTTGTCAATCAGTTGAAGACCTGGAGAG
ACGCTCAGAGTTACTGCAGACAGAATCACACTGATCTGGT
CACTGTGAGGAACCAGAATGAGAATCAACAGCTGGAGAAG
TTCATTAATAATAGAAGCTTATCTGGATCTCCAGTCTGGA
TCGGTCTGTTCAGAGACACATGGCAGTGGTCAGACAACAG
CACCTCCTCATTCAGATACTGGGCAGATAATTTTAAAAAT
GTTGGAATAAATGCAGCGATTCAACCAAACACACAGGGAC
AATGGGCTGACTACTCTAGTGATTGCAATCAGATTTCGTT
TGTGTGTCATGAAGATAAACTGATTGTGATCCAGCAGAAT
CTGTCGTGGTCTGAAGCTCTGAGATACTGCAGACAGCATC
ATGTGGATCTGGTCTCGGTTCAGTCAGTGGAGATGCAGTA
TGAGGTGATGAACGTGGTTAAACTGGCGTCTACTGAGGCG
GTGTGGTTGGGTTTACGTTTCTCCCACATTTTGGGCATCT
GGTTCTGGTTGAGTGGAGAGACCGTGTGCTATCAGAACTG
GGCTCCAGGGAACGGCACATCAGACGAGGACTGTGAGCCC
ACAGTGAGATCTGGAGCAGTTCAGTCTGGAGGAGATCAGA
CCTGGATCAGCCGTCCTGAAACTGACCGACTCAACTTCAT
CTGCAGAAACTACTGAGAGTGAA

si:dkey-28d5.10 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-28d5.10-201 1143
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-28d5.10-201 Contained in:
[BAC] DKEY-28D5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000020899 (1),  Ensembl_Trans:ENSDART00000147669 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC171481 (1) 1271 nt
GenBank:CA472374 (1) 895 nt
GenBank:CN022314 (1) 832 nt
GenBank:CF997417 (1) 765 nt
GenBank:DT068150 (1) 755 nt
GenBank:BQ259957 (1) 613 nt
CITATIONS (2)