Transcript

si:dkey-28d5.9-001

ID
ZDB-TSCRIPT-090929-4933
Name
si:dkey-28d5.9-001
Previous Names
None
Transcript Type
pseudogenic transcript
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020898 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020898|OTTDARG00000017317|ZDB-GENE-060503-449 si:dkey-28d5.9|no_translation DKEY-28D5.9-001 LG_ CR318599.18 Danio rerio unprocessed_pseudogene none, 867 bp
ATGGCCCAGACTCTATATTTCCCTCTTCTCCTCATTGCTT
TCTGCTCCATATCTGAATGTGTTCAGCGTCAGTATCACTT
TATAAATGAGAAGAAGACCTGGACTGAAGCTCAGAGTTAC
TGCAGAGAGAAATACACAGATCTGGCCACTGTTGACAACA
TGAACGACATGATCCAGCTGAACAAGAGTGTGAATGTGAA
TGATGGTGTCTGGATTGGTCTTCAGGGTACAAATGTTTAT
AATTGGCATTGGTCTTCAGGTGATCCTGCTCTCTTTCTGA
ACTGGGCATCTGGACAACCTGCCGGCAGTGATAATTGTGC
TGTTATGAGTAACGGAAAGTGGTTTGTTTGGGCATGTAGT
GCCACTTGGATTTTCATCTGCTACAACATGAGCACAGGAC
TGGTGTTTGTCAATCAGACGATGAACTGGAGAGATGCTCA
GAGATACTGCAGACAGAATCACATTGATCTGGTCAGTGTG
AGGAACCAAAATGAGAATCAACAGCTGGAGAAGTTCATTA
ATGACAGAAACTCATCTGGATCTGCAGTCTGGATCGGTCT
GTTCAGAGACTCATGGCAGTGGTCAGATCAGAGCAACTCC
TCATTCAGATACTGGAAACCTGGTGAACCTAAACCTCCAG
TTGATAAACGCTGTGCAGTGGGTTTACGTCACTCCTGCGC
TTTGGGCATCTGGTTCTGGGTGAGTGGACAGACCGTGTGC
TATCAGAACTGGGCTCCAGGGAACGGCACATCAGAGGAGG
ACTGTGAGCCCACAGTGAGATCTGGAGCAGTTCAGTCTGG
AGGAGATCAGACCTGGATCAGCCGTCCTGAAACTGACCGA
CTCAACTTCATCTGCAGAAACTACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations