Transcript

smap2-201

ID
ZDB-TSCRIPT-090929-4817
Name
smap2-201
Previous Names
  • smap2-001
  • si:dkeyp-89d7.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020603 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020603|OTTDARG00000017092|ZDB-GENE-060503-374 smap2|OTTDARP00000017402 DKEYP-89D7.2-001 LG_ BX276085.8 Danio rerio protein_coding NOVEL, 1257 bp
ATGACAGGCAGATCAGTCAAAGACATTGACCGCTATCAGG
CGGTTCTCACATCCCTTCTCACGTTAGAGGAAAACAAGTT
TTGCGCGGATTGTTACGCCAAAGGTCCCAGATGGGCATCC
TGGAATCTTGGTATCTTCATTTGTATCCGCTGTGCGGGAA
TCCACCGGAATCTTGGTGTTCACATCTCACGAGTGAAATC
TGTAAACCTGGACCAGTGGACTCAAGAGCAGATACAGTCT
GTTCAGGAAATGGGGAACGCCAAAGCTCGGAGACTATACG
AGGCCTTTTTACCAGAGTGCTTCCAGCGCCCAGAGACAGA
CCAAGCGGCTGAGATTTTTATTCGTGACAAATATGATAAG
AAAAAATATATGGATAAATGCATTGACATCCAGTCATTCA
GGAAAGAAAAGAGTGAAACAGTAACAAAAGAGGCTCCCGT
TGTTTTTGAAAAGATGAAGCTGAAAAAGGACGAGTCACAA
CAATTCAAAAGCACTCCAAAGAAACAGTCACAGTCTGTCA
ATGACTTACTAGGACTAGATGCCCTAGCACCTCAACCTCC
AGTGACCAATGGCAAACCAAGCGCTGAAATTAGTCCTGCA
CTCGACCTCTTCAGTTCTCTGCCTGCAGCCGTCAGCAACT
CAAACTCTGCCAGGAGCACGCCCAGCTCAGGGTCTATGCC
CACTGGACGGGTAGCAGCATCAGTGCCCGAAAACCTCAGT
CTGTTCCTTGATCCTCCAACCAAAAGTGAAGACAGTGGAA
AAAAGTTATCCAAGGACTCAATCTTGTCCCTGTACAGCAG
TACAGCGCCACAAACAAACATGGCGGCTCATGCTGGCATG
TACATGGGAGCAACCCAGATGGGCTATGTTCCTGCTGCAG
GATATGGCCAATACCAGGCCCTGGGTGCCCAGCAGGGCAT
GATGGGACCTATGATGGCTCCACATATGAACATAGTGGGA
CAGGCGGGTGTCATGCCGCAAACCGGAGCGGCAGCTGCTC
CTCCATACATGGCAGGAGTGCAGGGCGGTGTAATGGGAAT
GCAGAACGGCATGATGGGAAACATGGCAGCAGTTCCTCAG
CAGGCATATGGAGCACAGCAGGCCCAACAGCTGCAGTGGA
ACATCAGCCAGATGACTCAACACATGGCAGGAATGAATTT
CTACGGTGCCAATAACGTGATGGGATACGGGCAGTCCATG
GGCGGTACAGCTGCGCCCGGGTCAAATCAAATGCTTGGGT
CACACGTGTGGAAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations