Transcript

ppp1r18-201

ID
ZDB-TSCRIPT-090929-4739
Name
ppp1r18-201
Previous Names
  • ppp1r18-001
  • si:dkey-263h23.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020375 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020375|OTTDARG00000016911|ZDB-GENE-060503-350 ppp1r18|OTTDARP00000017203 DKEY-263H23.1-001 LG_ CR391989.16 Danio rerio protein_coding NOVEL, 4779 bp
GGAAAACTTTATTCCGGCGAAAATAATCACACGGAGGAAA
AAAGAATTACTGGATGTCCCAGGGGAAAATTGTGTTTTTG
CAAAACTGATTCATCCAGCCCTGCGTGGTTATGTCTCTGT
CGGCGCTACCAGAATGGAAGCAGATGCTTCTGGAGCGAAA
GAGAAAAGAGGAGGAGGAGAGAGAAAGACGAGAACGTGAG
GAAGAAGAGAGGCTGGCCAGCATGCCAGCCTGGAAAAGGG
AGATCATCCAGAGAAGAAAAGAAAAAGAGAGAGAGCGAGA
CATACAGCGTATTCCCGATGTGTTGGCCAGCACTGAGGAC
ATCATTACAGAACATCTCCCCAAGGTAAAACAAAAGATAT
CCAAAGAAACCTTCCAACAGAACCCGTTCATCCGCTCTGA
AAACAGCTTTAGGAAGGATAAAAGGGTGATTGGAGAGAAT
GCATGTAAAAAGGCTGGTAGTAAATCCGGGAGGGATCATA
ATAAAGAAAAAGAAGTCTGGAGAGGACGAGATAGAGAGAG
TAAAAATGAAGGAAGAGAGCAAGAGAGAAGCACCGGGAGA
GAAGGCAAGGAGACGGGTCCATTCTCTCCAGTCGTGGGTC
TGAGAACGATCCAGGCCAACAATATTATCATTATTGAGAA
AGATAAAAGCGGGAGGGAGAAGGTGGAGAAGGAGGTGGAG
GAGGACGAGAAAAGGATGAGGATGGATTTGAGGGAGTTTC
TGGCGGGAGGTGGGAGTGTGACGGAGATTAGAGCATCGGA
AGTGCTGATCATCAAACCTCCTGTGACGGAGGGGAAAAGA
GATGGAGAGAGTGGAGGAAAGATGGAGAGAGGGAGAGGGG
AAGAAAGGATAGAGAGAGGGAGAGGTGAAGAGATAGGGGT
AAGTGAAGAACGAAGGAGAGATGAAGAAAGTTTAGAGAAA
GGGAGAGGTGAAAAGCGAGGGATTAGTGAAGAGGGATGGA
GAGGTAAGGGGAGGGGGGAGGACTGGATTGAGAAAGGGAG
AGGTGAAGAGAGGATAGAGAGAAGGAGAGGTGAAGAACGA
GGGAGAAGTGAAGAAAGAAGGAGATGTGAAGAAAGTTTAG
AGAAAGTGAGAGGTGAAAAACGAGGGATAAGTGAAGAGAG
ATTGAAAGGTCAAGAAAGATGGAGAGGAGAAGAGAAAGGG
ATAAGCGAAGAACGAAGAAGAGGTGAAGAACAAGGGATAA
GTGAACAGCGAAAAAGAAGTAAAGAGCGAGGGATAAGTGA
AAAACAAAGGAGAAGTGAAGAGCAAGGGATAAATAAAGAG
CGAAGAAAAGATAAAGAGCGAGGGATAAGTGAAGAGCTAG
GGAGACGTGAAGACTGGATAGAAAAAGGGAGAGAACGAGG
TAAAAGTAAAGAACGAGGGAAAAGTAAAGAACGAGGGATA
AGTGAGGAGCGTTCAGAGAAAGAGGGAATATGGAGCTCTA
TGCAGAGAGTGCTGGGCCACAGAGCTCCGGGCTGCAGTGG
GCAGGTCAGTGTGCCCGCTCGGGTCAGTGGGCGGGTCAGT
CAGCTGCTCAGTAAATTCGGGGAAAACCCCAAACCTCCAC
TGAGATCCAAAAGCACAGAATCCCTGAACCAGCCCGACAA
GACCAGGGCCCGATACAGCACAGGAGACCTCTCAGTGCAG
GACGTCCCAAACCTGGAGGAGCCGGAAAACAATCCGACAC
TCCGAGGAGTCCCGAAGAGATCCTTCAGCTTCTCAGACCG
CGTGATTCGACAACAGGAGAACCGAGATTTTAAGGCTGTG
GAGAGAACACACTCTGACCGCAGAGTCAAAACTCAAGACC
AATCAGAGGGTCAATCAAGGGTCAACAGGAAATCTAAAGA
TGATGAGGAAAAGAGGCAAACAGAAAATAGGGAGAGGAAT
GTTTGTGGAAAGACAGAAGATGAAGGCTTCACTGTAGCCT
CCATCGTCAAAAATCCAGAGGAGGTCGCATTTGCAAGGCG
AATTCCTATCAAACATGAGGAGAGGGAGTGCGGAGAGAAC
AGAGAAGAGAATGAGGTTGAAATAGATAAAGAGATGCATA
GAGATAAAAAGCAAGAGGAAAAATGGAGTCTCACAGAATT
CCAGAATGATTCCGATAGAAGACAGAATCAGGACCAAGCA
ACTCTTCCAGATTCAAGACAGTCCCACGGTATATACATCC
CACCTTCAGATGACAGTACTACAGATCTCCCTGCAGACAT
TCAGTGCCAATGCAGTGTCAACACTGCAAACACTAGTTGT
CCATCTACAACCTGTTCCGTACAACAACAAGCAGTCCTTA
CTCAGCACACAGAAGATCTGTTGAGCAAATTAGGCAAAAT
CCAATCAGACATAGAGTTTAAAAGTTCAACGCATGCATGT
TCACATGAGGACTCAGACATGATCTCTGATGAACTGAGTT
TCCAAGAGCATCAAGACTATGAAAACTTTCCAAAGCAAGA
GGCATATTATTCCTCACAACTCCCAACAACACTATCCCAG
AGCAAGCTCTGCACTCAAGAAGGAATCACCATCCCCAGAA
CAGTGTTTTATGGAGTCGATATATCAGCGAAAATAAGAAG
ATCGAGTCTGCCTGCTGGACAAGAGGGTGGACAAACTGAG
AGGAGAGGAAGCTGGAAAACAGGCCGACCTTTGACCCGAG
TGGAGTCTCTGAAAGAGAAAATTCGCCAGCAGGAAAAGGA
AACACAGAGAAGTAGACATGATGAAACTGAAGCAACTACA
AGCAAGCAGGAAGAAACCACAGTGCAGACTCTCACACCGC
TTGACGTCACACAGGAAGTCAGCATGGCAAAGTCAAGCCC
TCAACTTCCTGTTCCTGATTCTCTGTCGCTCTTGCAGTCA
TCAGAAAGAGAAGTAGTGGAGATCACATCCAAAAGTGATA
TCTGCGGAACTAAGAAAAGAGCTTGCAATGCTCCGAGAAC
ACAGGACTTTGACGGAGAAGACGATAGAATTGAAAGAGAG
GAAGAGTTGTTAGAGGAAGAGTATTTTCCTCCTTCTCTTT
CTCCCTCTCCTACTCTTTTAGAGTCTTTGGACGCCATGAG
TCGGATTTATAACCTTAAGACTGTAGGGTCTAGAACTACA
GTGTGTATCGGCGAAAGATCAGCTGATGTGTCCCCACATA
GTGGACTGCAAGGTAAATACAACCCTATTAGACAAGCACC
TTCGCCGGACGTCCTTCCAGAAAAGGCCAAGGTGTGGAAT
CATGAGAAATCTGAGACCGTGGAGTCGACAGGTGTTCAGA
CGGTTCAGCGTCAGGTGGAGAGACTACAGCTACAGAGGGA
ACCGGAAGAAGGATGTGGTTTCCCCAAAGACAAAAAATCA
AGTCGCACCATTGTAGAACCGGAGGTGAGAATCGCCGAGG
GTCAAAAGAGGCCTGACATCTTAAGAGAGACTCAGATTTC
CACCCCAAGATTTCAACCTCAACAAAAGGTCAGATCATTC
ACAATCAATGCCCAGAACTCGGCGAAACCTCCAGAGCAAA
TCTCTCCATCATCATCAGCGGGATCGCCCTCCTCGTCAAC
TCCCTCTCCTCCTCTGTTCTCCATTAGAAGCGCTTCAGGT
GGGCCGAGTAAGAGAGGAACGACAATCACTATAACCCCCC
GGAGATCTGCTGGGTCGTCCTCGCCTGGGAGTACACCGAC
AGCGACCTCCCCCACAGCACCCAAAGCAGCCCCCCAGACC
CAAACGCCCACCCCTGCCCCCATCAGCACCCGGGAGACGG
GGAAAAAGAGGTATCCCACGGCCGAGGAGATCCAGGTGAT
CGGAGGATATCAAAATCTGGAGCGCTCCTGCTTGGTGAAG
AGTAGAGGGACACCCAAATCGGTGAAGGTGTGTTTCGATG
AGGTCGAGCTGGAGCGAGTGTGTGAATATCCCTCTGAGGA
GTGTGTTCTGGCCTCTCTTCCATGTTTTCCTCAGTCTGGA
CTGGAGGACGGAAATCGAGACGAGCAGGAGGAAGATGATG
AAGACGAGGAAAGCAGCAGCGCACTCACAAATCCATCAGA
CATCAGTGTGTGCGCAGGCAGGACTCGATTCCTGAAAGTC
GATGAATCCTGCAGACGGCTCTCTAAATGACAAACCATGG
CATCCTTTAGATTTTACTTTTTACATTTCAGGAAGGTGTA
AGTGATGTTAAACTTTTAAAAAACTGGTTTCAAAATTTCT
ATGTAGCTTTTCATGTCCTGTCAGAGAATCAGCAAGCACA
AAGTTTAATTAATTGAGGTTATATTTCTGAAGTTATTGCT
TTATGTTAAGGGAAGCAGAAAATAAACTGTGATTTTACAC
ACTGTAGTATCTGGGAATGACACCCGCTTTGGTATGATGG
TTTGCACAATTTATTGAGTTTCGCAGTTAAATCATTTATG
ATCTTTGTTTATTAAAATATAACTGGAATAGATTTTTTCA
TTTACTGTATTTTTTCTGCACCACATTTAAAAAGATTTAT
TTTTATTTATAAATTCTTATATTTGATTCATGTTTAGAGT
TACTCTCGTAGCATGTTTAAATATGATGATGATCAATAAA
CATTAGATTATACATTATATTGTGATATGACAAGTTATTA
TCACCAGATTGTAAAATAAATATAATTACAGAGTTTATGT
GAGTGTGTGAGAGTGTCTATATGGATATGCAATGGTTATA
TTTGGATTTTTATAATGTGATCAAATGAAAATCCATTTTT
GTACATTGTACTTGAAGTACCATTTTGTCTATGTTACCTT
TCCAACGAAATGAAGAAGCACTTTTAATATGTTAATAAAC
ATTACAGACATGTACAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations