header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4690
Transcript Name: baiap2l2b-201
Previous Names: baiap2l2-001, baiap2l2b-001, si:dkey-205o12.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020223 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020223|OTTDARG00000016803|ZDB-GENE-060503-339 baiap2l2b|OTTDARP00000017071 baiap2l2-001 LG_ BX571961.11 Danio rerio protein_coding PUTATIVE, 1551 bp
ATGTCTGGAGTGAACAGTGACCTTTTACACAGATCAACTT
TGAGTGTTTATAATAACCTCATGGATCAGTTTAATCCTGG
CTTGCAAAAGCTGGTCACTTTAGGAAACAGCTACATCAAA
GCTTTTCAAGCGTTGGCTCTGACAAGCGAAGCCTACTTCA
GCGCTCTTGCTAAGATGGGCGAACAAGCTCTCAGCACACT
ATCATCTAGATCACTCGGCGACGTGTTGATCCAGATATCA
GAGACTCAGAGGAAGCTGACGGCTGAGGCAGAGGGAGTGT
TCCGCTGGTTCCATGTGGAGGTTCTGCAGGCCATGGACAA
GAACGTGAAGCTGGACGAGGAATACATTGAGGGCAGTCGT
AGAGTGTATGAACTGGAGGTGAGGAATCAGGCGGCATCGC
TGGAGCGTCAGCTGAGACGTGGTGCCTTCAGAGACTCACT
GGAGAGCAGCGAGTACATGCAGTACCTGAGGCAGAGTCAG
CATGAGATTCTCAAAGAGGAAGAAAGGAGATATCGTTTCT
TGGCTGAGAAACATTGCGGACTTACACAGTCACTTCTATA
CCTTATCAATAAGACGGGAGTATCTCTCCAGCAGAGAGCA
GATGGATGGAAAGAGAAAGTCAGCGAGAGCAGAAGCTCCA
GACCTCGAACGCCCACTCCATTAGATCAAGAGGCTCAGTT
AAAAAGTTCTGTGGGCTCTCTGCTGCAGACTGGAGACCGA
GAAATGGACCGCGAACCTCTGGGGAGAGTGCCCTCTAGAG
CCCCGTCTCCTCTCCCCAGTCGTTCCCGCTCCAGCTCTGT
GGGCGAGTCTTTAGGTCTGGGCGGCGGTCGCTCCATGAGG
GCCATCGTTTCACATCCCGCTTCATCCAATCCGGTCCTGC
TGCCGTTTGCCCGTGGCGACCTGTTGACTGTGCTCATACC
AGAACCACGCAATGGTTGGCTGTATGGACGCCATGATCCA
AGCCTACGCCAAGGCTGGTTTCCTGCTGCCTACGTGGCAT
CCACTGAAGACTTTCTACCTGTGGGCTTAAGTATGTCACA
CCGAAGCCACAGCATGAACAACCTCCTGGAGCCGACCAGC
CAATCAGAATCCGACACCCAGACCTACAGTGAAGTTTCTT
CTCCAGTGGTCTCCATGCGCCGTGCGTCGGCAGACGTTCG
CTCAGTATCTCCCCTCCCCGAAAAGAAGACAGAGTCCAAC
AACGAGCTCAAGAGCGGCCAGAAAGTCTTCCACGAGATTC
CTGCTCCAGCCACACAGCTGCGCCGTGGCTCGGCCGATGT
TCGCTCGATATCTCCTCTCCCTGACAGGAGGGCGGAGTCT
CATTTTGAGAGCAAAGTGGAGCTCAAACATTACAACGAAC
TTCCACCTCCAGCTCCACCCCTTCCAAACTCTCCTCTGCC
TGAGCGAAAGACTGACTCAACCTCAGAGAGGCCAAGTACC
CAAGGACAACCACCAGAGCACCCTCTTTTTCCCAGAGGAT
CAAATCCATTTGCCACAGTGAAGCTTCGTCCCACTGTTAC
CAATGACAGATCCGCTCCACGAATCCAGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
baiap2l2b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000020223 (1),  Ensembl_Trans:ENSDART00000143811 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)