Transcript

si:dkey-28d5.3-201

ID
ZDB-TSCRIPT-090929-4685
Name
si:dkey-28d5.3-201
Previous Names
  • si:dkey-28d5.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020217 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020217|OTTDARG00000016799|ZDB-GENE-060503-919 si:dkey-28d5.3|OTTDARP00000017066 DKEY-28D5.3-001 LG_ CR318599.18 Danio rerio protein_coding NOVEL, 1144 bp
CACAATCTGAAGCTGCAGACAGAAACATCAGACTGAGAAC
AGAAACACACCACTTCAGAGAAATGGCTCAGACTCTATAT
TTCCCTCTTCTCCTCATTGCTCTCTGCTCCATATCTGAAT
GTGTTCAGCGTCAGTATCACTTTATAAATGAGAAAAAGGA
ATGGGCTGATGCTCAGAGATACTGCAGAGAGAATTACACA
GTTCTGGCCACTGTTGACAACAGGAATGACATGATCCAGC
TGAACAAGAGTGTGAATTATGGATTTGTTGAGAACATCTG
GATTGGTCTTCACAAGACGAGTGTTTATAAATGGCATTGG
TCTTCAGGTGATCCTGTGTCATTTCTGAACTGGGCATCTG
AACAACCCAACAGCAGTAATGAGTGTGCTGTTATGAATAA
TGGACAATGGATTAATGAGAAATGTAGTAATACTCGTGTC
TTCATCTGCTACAACATGAGCAGAGGACTGGTATTTGTCA
ATCAGGAGATGAACTGGAGAGACGCTCAGAGCTACTGCAG
ACAGAATCACATTGATCTGGTCAGTGTGAGGAACCAGAAT
GAGAATCAACAGCTGGAGATGTTCATTAATGACAGAAATT
CAGCAGCCTGGATCGGTCTGTTCAGAGACTCATGGCAGTG
GTCAGATCAGAGCAACTCCTCATTCAGATACTGGGCCCCT
AATAATCCAAAAGTTGCATACAACGCAGTGATTGAACCGA
AAACATTGGGACAATGGGGTGACTACTTTAGTCCTTACCA
TCAGTATCCTTTTATATGTCATGAAGATAAACTGATTGTG
ATCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAGATACT
GCAGACAGAATCATGTGGATCTGGTCTCGGTTCAGTCAGT
GGAGATGCAGCGTCGTGTGATGAACGTGGTTAAACTGGCT
TCTACTGAGGCGGTGTGGTTGGGTTTACGTCACTCCTGCG
CTTTGGGCATCTGGTTCTGGGTGAGTGGAGAGACCGTGTG
CTATCAGAACTGGGCTCCAGGGAACGGCACATCAGAGGAG
GACTGTGAGCCCACAGTGAGATCTGGAGCAGTTCAGTCTG
GAGGAAATCAGACCTGGATCAGCCGTCCTGAAACTGACCG
ACTCAACTTCATCTGCACAAACTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations