ZFIN ID: ZDB-TSCRIPT-090929-4596
Transcript Name: zgc:86811-201
Previous Name: zgc:86811-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019908 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019908|OTTDARG00000016557|ZDB-GENE-040625-113 zgc:86811|OTTDARP00000016826 CH211-214J8.6-001 LG_ BX510923.8 Danio rerio protein_coding KNOWN, 1087 bp
GACGTCATCAAACGGACGCCACAAATTTGAACACGTTTTT
ATGTTGATCTGTACAGTGACAACAACAGATTAACTCCATA
TCACACGATTTTGTTTGCGTAACAATTATAAGATTAAAGT
TTGAGTAAAACGAGTTGAGCAATTAGTTGTATTTTAACGT
GTGATACCTTGCGATGAGAATCATGAAGAGACCTAACATT
CTTCTCACAGGAACCCCTGGAGTGGGAAAGACGACTTTAG
GGAAAGAGCTGGCTCAGAGAACGGGACTAACCTATGTCAA
TGTGGGTGATTTGGCACAGGAAGCTGAATTGTTTGATGGT
TTTGATGAAGAATACCAGTGCCCTATATTGGACGAGGACA
GGGTTGTGGATGAGCTGGAGGACCAAATGGGAGATGGAGG
TGTAATTATTGATTACCATGGCTGTGATTTCTTTCCTGAA
CGCTGGTTTCACATTGTTTTTGTCCTCCGCACTGACAACA
CCAATCTCTACAATCGTCTCGAAAGCAGAGGGTACACAGG
AAAGAAACTCCAGGATAATGTGCAGTGCGAGATTTTCCAG
ACTATATTTGAGGAAGCCGTGGAAGCCTACAAGGAGGAAA
TTGTGCACCAGCTTCCCAGTAACACTCCTGAGGACCTGGA
GAGGAATCTAGAACAAATTGTTCAGTGGATTGAACAATGG
ATGAAAGACAACAATTGACATGGCTCATTATACGTGAAAG
GCTCAAACATGTTTGAGTTTGTGTCAAAGAAAGCATATAT
CACATTTCATAGATAAAGTACTCCAGATTGACTATGGTTC
ATTATTATTGCGCTAAAGACAAAAAAGTGTGATACCATTA
ACAGTTACTCGGTCAGTTAAACACTTTCATCCTGAATTGG
ATAAATAAATATTTTTATATTATATTTAAGGGTCTCTGTG
TATATATTTAATACTTCAGAAAGGATGGTGGATTGCAACT
TCAAAATTGAGAAGCTAAAAGTTTGATCCCACATGAAGAA
ACCACGATTTAAATAGCTATAAAAAATATTACAAAACATT
ATCCAATGAAAATTGTTAAAATTATTAAAAAATTTTTAAA
TGAATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:86811-201 Contained in:
[BAC] CH211-214J8 (1)

Genome Resources: Vega_Trans:OTTDART00000019908 (1),  Ensembl_Trans:ENSDART00000144303 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC071472 (1) 1112 nt
GenBank:BM572126 (1) 517 nt
GenBank:BI867933 (1) 497 nt
GenBank:CB359216 (1) 423 nt
CITATIONS (2)