ZFIN ID: ZDB-TSCRIPT-090929-4594
Transcript Name: cyb561a3a-201
Previous Names: cyb561a3a-002, cybasc3a-002, si:dkeyp-38h2.4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019828 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019828|OTTDARG00000016491|ZDB-GENE-060526-374 cyb561a3a|OTTDARP00000016758 DKEYP-38H2.4-002 LG_ BX323062.10 Danio rerio protein_coding NOVEL, 1064 bp
CACTACACTTCCCATGGAACCTTGCGGTCAAACCGGAAAA
TGTCTTCACACCAGCTGCATTCTACCAAAACATCGTAATC
CTCATCTTTAAAACGAAATCGAAAATCATAATGGGGAATT
ATGGAAAGAGGAACTGAGCTCAAGAAAAACGCTGTCACGA
GTTTATTTGATATTTTGGAGACACCAAAGCTCTTACAGGA
TGAGAGGAATTGTTGGATTTTACATAACCTATCTTCTGTG
TCTGATTTTGGGGATCGCCTGTGTGGTTTTAGTTGTTCAC
TGGAATTTCATGTATCGAGATGGATTTGCATGGGACGGCT
CATCCAAGAACTTCAACTGGCACCCAGTGCTCATGGTCAC
TGGCATGCTGGTTCTTTATGGGAATGCGGCCGTAGTGTAC
CGTATTCCTCTGACGTGGGGTCACAATAAGCTCCCCTGGA
AGCTGCTACATGCTGGGCTTCTGCTCCTTTCTTTCATTTT
TTCTGTTATCGGACTTTGTGCTGTGTTTAACTTCCACAAT
GTACACCACACAGCCAACCTTTATTCTCTCCATAGCTGGG
TGGGGATTTGCACCGCTGCACTTTTCACTGCACAGTGGGT
CATGGGATTTACCTCATTTCTCTTACCTTGCACCCCAATG
GCCGTGCGTGCTTTTGTAAAGCCAACTCATGTTTGGATGG
GAGCAATGATCTTGGTACTGAGCATTGTGTCCTGCATCTC
AGGGATCAACGAAAAGCTCTTTTTTGTACTAAAGGAAACC
ACCAATGGGACAAAGCCTTATTCTGCCTTGCCACCAGAGG
CAGTTGCTGCTAATTCTTTGGGAGTCATCATTGTAGCATT
TGGATTGGTTGTTTTAAAAATCTTATCCAATCAGATGTGG
CAACGTCCTGAGCCTGGCGATGATGAGGGAGTTTACAGGC
CACTTGCTTATGATGGAAGCTGATGTCTCAGAGATGAATG
TCTGAAAGCAGTATGTTTAATTGCATTCTGGATTCCAAAG
AAATCAAAGTTACAAAATATTATCTTTATGTTTCTTGTTA
CTCAGAGCTGGAAAGACTTTTTTT

cyb561a3a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cyb561a3a-201 1064
cyb561a3a-202 (1)    Ensembl 1145
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyb561a3a-201 Contained in:
[BAC] DKEYP-38H2 (1)

Genome Resources: Vega_Trans:OTTDART00000019828 (1),  Ensembl_Trans:ENSDART00000098590 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK147761 (1) 794 nt
GenBank:CK693784 (1) 750 nt
GenBank:BI883619 (1) 520 nt
CITATIONS (2)