Transcript

drd7-201

ID
ZDB-TSCRIPT-090929-4593
Name
drd7-201
Previous Names
  • drd7-001
  • si:dkeyp-38h2.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019827 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019827|OTTDARG00000016490|ZDB-GENE-060526-372 drd7|OTTDARP00000016757 DKEYP-38H2.2-001 LG_ BX323062.10 Danio rerio protein_coding NOVEL, 1332 bp
ATGGTAAACCAGACTGAAGGTTACGTCTCAGAGCTGATAA
CCCGCTCCACGACTGCTTGCCTGCTTTTTATTTTTGTGCT
CTCCACCTTTCTAGGGAATGCTCTGGTGTGCACAGCGGTG
GTACGGTTTCGTCATCTGCGCTCCAAAGTAGCGTACGTGT
TTGTTGTGTCTTTGGCTGTTTCGGACCTCTTAGTTGCCAC
TCTTGTAATGCCATGGAAGGCAGCTGCTGAGATTGTGGGT
TTCTGGCCGTTCGGGAGCTTCTGTGAAGTATGGATAGCTT
TTGACATCATGTGTTCCACTGCCTCCATTCTCAACCTGTG
CATCATAAGTGTGGATCGTTACTGGGCGATTGCTATCCCG
TTGAGCTACGAGCAGAAAATGACCAGAAGAGTGGCGTTCG
TCATGATTGGAGTGGCATGGACGCTTTCTGTCCTCATCTC
ATTCATTCCTGTGCAGCTGAGTTGGCATAAGTCTATCGAC
CCTATAGAAGACCTGGCTGAGAAATGCGATGCCAGTTTAA
ACCGCACTTACGCCATCACTTCATCTCTGATCAGCTTCTA
CATCCCAGTCTCCATAATGATTGTCACTTACTCACGCATC
TTCCTCATAGCACAAAGGCAGATCCGAAGGATATCGATGC
AAGAGTGTAGCATCAAACATGTCCAGTCCTGCCAAAGCTG
CAATAAAGCTCCTGAAGAGAAGTTAAAAAGTTCATTTAGG
AGGGAAACCAAAGTCCTGAAAACTCTGTCGATGATCATGG
GGGTGTTCGTCTGCTGTTGGCTGCCTTTTTTCATTCTCAA
CTGCATGGTGCCGTTTTGTGATCCTGGCCTCCACAACGCC
GGTCAGATCCCATGCGTCAATAAGACCACCTTTGATGTGT
TTGTGTGGTGTGGCTGGGCGAACTCTACCTTGAATCCTGT
CGTTTATGCATTTAATGCAGAGTTCCGCAAAGCCTTCTCC
AGCATCCTGGGATGTGGGAAGTTGTGCTGTCAGAATAATG
TGCAAACTGTTGACTTCAGCAACGAGCTGGTGTCGTACCA
TCGAGACTCCACAAATCTTCGAGATGTTCACCTGTTCGGT
CATCCCTGTCTGCATCCACACGCTGTCAGGGAGGGAAGTG
ACAAAGACATGTGCTTTGATACTGTTTCACAGATGGCTGA
AGTTCCTTACGAGATGGAATGTAACTTTGTATATGGAGAA
AGGCATCCTGTGGGAGAAACAGAGCTATCACTTGATAAAA
TCATACCATTTACCAAAGAAGATGAGTTGGTGTCACTTGA
ACATGTTGTTCGTAATGAAGTCGAGTCTCCTAGTATATCT
GGAATACTATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations