ZFIN ID: ZDB-TSCRIPT-090929-4593
Transcript Name: drd7-201
Previous Names: drd7-001, si:dkeyp-38h2.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019827 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019827|OTTDARG00000016490|ZDB-GENE-060526-372 drd7|OTTDARP00000016757 DKEYP-38H2.2-001 LG_ BX323062.10 Danio rerio protein_coding NOVEL, 1332 bp
ATGGTAAACCAGACTGAAGGTTACGTCTCAGAGCTGATAA
CCCGCTCCACGACTGCTTGCCTGCTTTTTATTTTTGTGCT
CTCCACCTTTCTAGGGAATGCTCTGGTGTGCACAGCGGTG
GTACGGTTTCGTCATCTGCGCTCCAAAGTAGCGTACGTGT
TTGTTGTGTCTTTGGCTGTTTCGGACCTCTTAGTTGCCAC
TCTTGTAATGCCATGGAAGGCAGCTGCTGAGATTGTGGGT
TTCTGGCCGTTCGGGAGCTTCTGTGAAGTATGGATAGCTT
TTGACATCATGTGTTCCACTGCCTCCATTCTCAACCTGTG
CATCATAAGTGTGGATCGTTACTGGGCGATTGCTATCCCG
TTGAGCTACGAGCAGAAAATGACCAGAAGAGTGGCGTTCG
TCATGATTGGAGTGGCATGGACGCTTTCTGTCCTCATCTC
ATTCATTCCTGTGCAGCTGAGTTGGCATAAGTCTATCGAC
CCTATAGAAGACCTGGCTGAGAAATGCGATGCCAGTTTAA
ACCGCACTTACGCCATCACTTCATCTCTGATCAGCTTCTA
CATCCCAGTCTCCATAATGATTGTCACTTACTCACGCATC
TTCCTCATAGCACAAAGGCAGATCCGAAGGATATCGATGC
AAGAGTGTAGCATCAAACATGTCCAGTCCTGCCAAAGCTG
CAATAAAGCTCCTGAAGAGAAGTTAAAAAGTTCATTTAGG
AGGGAAACCAAAGTCCTGAAAACTCTGTCGATGATCATGG
GGGTGTTCGTCTGCTGTTGGCTGCCTTTTTTCATTCTCAA
CTGCATGGTGCCGTTTTGTGATCCTGGCCTCCACAACGCC
GGTCAGATCCCATGCGTCAATAAGACCACCTTTGATGTGT
TTGTGTGGTGTGGCTGGGCGAACTCTACCTTGAATCCTGT
CGTTTATGCATTTAATGCAGAGTTCCGCAAAGCCTTCTCC
AGCATCCTGGGATGTGGGAAGTTGTGCTGTCAGAATAATG
TGCAAACTGTTGACTTCAGCAACGAGCTGGTGTCGTACCA
TCGAGACTCCACAAATCTTCGAGATGTTCACCTGTTCGGT
CATCCCTGTCTGCATCCACACGCTGTCAGGGAGGGAAGTG
ACAAAGACATGTGCTTTGATACTGTTTCACAGATGGCTGA
AGTTCCTTACGAGATGGAATGTAACTTTGTATATGGAGAA
AGGCATCCTGTGGGAGAAACAGAGCTATCACTTGATAAAA
TCATACCATTTACCAAAGAAGATGAGTTGGTGTCACTTGA
ACATGTTGTTCGTAATGAAGTCGAGTCTCCTAGTATATCT
GGAATACTATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
drd7-201 Contained in:
[BAC] DKEYP-38H2 (1)

Genome Resources: Vega_Trans:OTTDART00000019827 (1),  Ensembl_Trans:ENSDART00000078755 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)