ZFIN ID: ZDB-TSCRIPT-090929-4592
Transcript Name: zgc:153409-201
Previous Name: zgc:153409-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019826 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019826|OTTDARG00000016489|ZDB-GENE-060929-224 zgc:153409|OTTDARP00000016756 DKEYP-38H2.3-001 LG_ BX323062.10 Danio rerio protein_coding KNOWN, 376 bp
ATATTGACTTCGCGGATCGAGATTAAGAGTACGTAATCAT
GTCTGGACGAGGCAAAGGCGGCAAAGGGCTCGGAAAAGGT
GGCGCTAAACGCCATCGTAAAGTTCTTAGAGACAACATCC
AAGGCATTACAAAGCCGGCTATTCGCCGTCTAGCGCGTCG
TGGCGGTGTAAAGCGTATTTCTGGTCTGATCTATGAAGAG
ACTCGAGGTGTGCTGAAAGTGTTCCTGGAAAACGTCATTC
GCGACGCTGTGACCTACACTGAGCACGCTAAGCGCAAGAC
TGTGACCGCTATGGACGTAGTATACGCTCTGAAGCGCCAA
GGCCGTACATTGTATGGTTTCGGCGGTTAAACTCCACTGG
ACCCAGTTTTAAAAAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:153409-201 Contained in:
[BAC] DKEYP-38H2 (1)

Genome Resources: Vega_Trans:OTTDART00000019826 (1),  Ensembl_Trans:ENSDART00000087894 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC095083 (1) 385 nt
GenBank:BC122275 (1) 385 nt
CITATIONS (2)