ZFIN ID: ZDB-TSCRIPT-090929-4591
Transcript Name: unc5db-201
Previous Name: unc5db-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019825 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019825|OTTDARG00000016488|ZDB-GENE-060531-162 unc5db|OTTDARP00000016755 DKEYP-38H2.6-001 LG_ BX323062.10 Danio rerio protein_coding NOVEL, 2706 bp
GATGCCCTTGCTGATTCCTTGTCATCAGTTGGTGGGACGT
TACCTCACTTCCTGCAAGAGCCTGAGGATGCTTACATAAT
CAAAAACAACCCGATTAAGCTGCGCTGCCGTGCCACCCCA
GCCCTGCAGATATTCTTCAAATGCAACGGGGAATGGGTAC
ATCAAAACCAGCATTCCTCACAAGAGTACATGGATCAAAA
CACTGGGGTAAAAATCCGCGAAGTGACGATCAATGTTACC
AGGCAGCAGGTGGAGGATTTTCATGGGCCGGAAGACTACT
GGTGCCTGTGTGTGGCCTGGAGTCATCTAGGAACATCCAA
GAGCCGCAGAGCCACCGTGAGGATAGCCTACCTCCGCAAG
AACTTCGAGCAGGATCCTCAAGGGAAGGAAGTGCCAATCA
AGGGCATGATTGTGCTGCATTGCCGTCCCCCAGAGGGAGT
GCCCATGGCAAAGGTGGAGTGGTTGAAAAATGAAGAACTG
GTCAGCGCACTTGAAGATGACAACATTGACACTCGTGCTG
ACCACAATCTGATCATCAATGAAGCCAGACTTTCCGACTC
TGCCAACTACACCTGCCTCGCCACTAACATCGTCGCAAAA
AGACGCAGTACTACAGCTACTGTAGTTGTGTTTGTGAACG
GCGGTTGGTCTCTGTGGACTGAGTGGTCTTCCTGCAGTGT
GAACTGTGGGAGAGGAGTTCAGAAACGCTCTCGGACCTGC
ACGAACCCTGCTCCTCTGAACGGAGGGGCTTTCTGCGAGG
GCATGTCTGTCCAGAAGATCGCCTGCAATGCAGTCTGTCC
AGTGGATGGAGTTTGGGAGGAGTGGAGCGAGTGGACGATG
TGTAGTGCGCAGTGTGAGAGACAGCGATGGAGGGAGTGCA
ACGATCCTCCACCCCGTCACAGAGGCAAGATGTGTGAGGG
AGAAGGTCAAAGCACAGAGAACTGCACTGGAGGATTGTGC
ACGCAAAATGGAAAGCTGATGCATGATGTTAAGCCACAGA
GCATGGAGAACTCAATGGATGTAGCGCTGTACTCTGGTTT
GGCTGCGGGTGTGATCGCTGTGGTTGTCCTCATCGTGGCC
ATTACCCTCTACAGGAAGAGCCAGAGCGAGTATGGAGTGG
ACGTCATTGACTCATCAGCTCTCGCTGGAGGATTCCAGTC
CTTCAACTTCAAAACCACCAGACAGGGCAATCCACTTCTA
CTGAATTCCTCCATGCAGCCTGATATAACCGTCGGCCAGA
CCTACAGCAGCCCAATCTGCTTTCAGGACTCCATCGACAA
AGAGCTCTTTGACCCCTTGCCCGACAAGGTCAAAGTTCAA
AGCTCCTTTATGGTTTCACTAGGTGTGGCAGACCGGGCCG
AGTACCATGTAAAAGCTCATCCACAAACCCTCCCTGCAAA
CCTTCACCCAAACTACAGCATGGTAGAAGGAAAGAAGACG
GCCACAATGGCTCCCAATGGACTTCACACCCCCGGGAAGA
TTCAGCTGAAGACAAGCGCTGTGTTTGGACACCTGGGTGG
CCGATTAGTCATTCCAAATGCAGGAGTGAGCTTGCTGGTT
CCTCACGGGGCGATTGCTGATGACACCTCTTGGGAAATGT
ACATGCTCATAAATCAAGGAGAGACTAGTGCCCAATCAGA
GGAGAGGTGTGAGATTCTACTGGGGCCAGAGATCACATAT
GGACCTCCGGGCCTAAGCCTGTCCTGTCCTGTTGCCATGA
CGATAGCTCATTGTGCTGAAGTCAGCGCCGAAAACTGGAA
CATTAAACTCAAGAGACAAACCAAGGACAACAAGTGGGAG
GAAATAATGTCAGTAGATGATGAATCAACCTCCTGCTATT
GCCTGATGGACTCACATAGCTGTCACTTGTTGCTGGATCA
GCCGGGCTGTTATGCGCTGGTGGGGGAGCCAATCACCGAT
GCCGCCATAAAGAGACTAAGGATTGCTGTGTTTGGCAGTA
TGGAGGCTTCCTCTTTGGACTACAGCCTGCGAGTGCACTG
TGTAGACGATACGCCACATGCCTTTCAGGGAGTGGTCACA
GCTGAAACCTGCAGAGGAGGTCAGCTTTTAGAAGAGCCCA
AGACACTGTTCTTCAAAGGAAACTGCCTCAGTCTGCAGGT
GTCCATCCAGGATATCCCTCAGTTTCTGTGGAGCATCAAA
CCCTTCACCACCTGTCAGGAATTCTCCTTCACCCAAGTGT
GGTATAGTAACCAGCAGCCTGTGCACTGTGCCTTCTCACT
GCAGAGACATAGCGCCGCCACCAACCAGCTCTCCTGCAAG
ATCAGTGTGCGGCAGGTCAAAGGTCACGAGCAGATCCTGC
AGGTCTACACCTCAGTGGGAGAGAATGAGAAAGAGACAGT
CCCATTTTTTATGCAGGCAGATTGCACGGTGACTTCACAG
ACAGGGGCCAAAGCCTTCAAAATCCCCCTGTCCATTCGTC
AGCGGATCTGCACCACCTTCGATACTGCCAACGCCAAGGG
CAAGGACTGGCAGCTCTTAGCTCAGAAACTCCACATTCAG
AGGAATCTGTCCTACTTCACCAAACAGAAGAGTCCCTCTG
CTGTCATTCTCAGTCTCTGGGAAGCCAGACATCAGGACAG
TGGAGATCTTGACTCGCTCGCAAGTGCTTTGGAGGAGATT
GGAAAGATTCACTGTAAAAGTCTGCCTCAGAGTCCAGATG
AGAACGAAACAGACTTTACGTTTTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
unc5db-201 Contained in:
[BAC] DKEYP-38H2 (1)

Genome Resources: Vega_Trans:OTTDART00000019825 (1),  Ensembl_Trans:ENSDART00000087857 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DQ228154 (1) 2705 nt
CITATIONS (2)